Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519672780:

Variant ID: vg0519672780 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19672780
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCGTGCTTGAATTGATCTCCGGAGGGAGATGTCAAGATAAATCCTGCCTCTGCTCCTTGGCTGTTGAGTGCGCCATCAAACGCCATTGTCCATGTCTC[G/A]
TTGTCGCCTTGGTTGTCTGACTTGTTATCTGGCATGGTCCAATCGGCCACGAAGTCGGCGAGTACCTGAGATTTGATGGCTGTTCGCGGCACAAAGTGGA

Reverse complement sequence

TCCACTTTGTGCCGCGAACAGCCATCAAATCTCAGGTACTCGCCGACTTCGTGGCCGATTGGACCATGCCAGATAACAAGTCAGACAACCAAGGCGACAA[C/T]
GAGACATGGACAATGGCGTTTGATGGCGCACTCAACAGCCAAGGAGCAGAGGCAGGATTTATCTTGACATCTCCCTCCGGAGATCAATTCAAGCACGCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.80%	4.00%	11.28%	62.87%	NA
All Indica	2759	1.80%	3.70%	10.29%	84.20%	NA
All Japonica	1512	63.20%	2.50%	5.82%	28.44%	NA
Aus	269	1.10%	13.80%	53.53%	31.60%	NA
Indica I	595	2.50%	0.30%	1.18%	95.97%	NA
Indica II	465	2.20%	12.50%	14.41%	70.97%	NA
Indica III	913	1.30%	1.40%	15.12%	82.15%	NA
Indica Intermediate	786	1.70%	3.70%	9.16%	85.50%	NA
Temperate Japonica	767	94.40%	0.00%	0.91%	4.69%	NA
Tropical Japonica	504	8.70%	7.10%	15.08%	69.05%	NA
Japonica Intermediate	241	78.00%	0.80%	2.07%	19.09%	NA
VI/Aromatic	96	5.20%	8.30%	2.08%	84.38%	NA
Intermediate	90	18.90%	6.70%	16.67%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519672780	G -> DEL	LOC_Os05g33490.1	N	frameshift_variant	Average:7.814; most accessible tissue: Callus, score: 24.531	N	N	N	N
vg0519672780	G -> A	LOC_Os05g33490.1	synonymous_variant ; p.Asn1443Asn; LOW	synonymous_codon	Average:7.814; most accessible tissue: Callus, score: 24.531	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519672780	NA	6.55E-15	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	NA	6.16E-13	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	NA	1.29E-13	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	NA	7.68E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	NA	1.23E-07	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	NA	1.17E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	NA	4.09E-16	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	NA	8.96E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	NA	1.46E-13	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	8.92E-06	NA	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	2.85E-07	NA	mr1632_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	NA	1.84E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	NA	5.30E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519672780	NA	1.92E-12	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251