Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519667518:

Variant ID: vg0519667518 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19667518
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:

GCGATCTTCCAGCAGCGATGGATCTCGGCAAGTCGGCTTCCACCAGCGCGACCCTGAAGAAGCTCCAAGAGGACGGCGCCCTTCCTGGCCGTGAAAAGGC[A/G,T]
GAGAGGGAAGCAGGAGGTACTAATCCTCAGCCCATCTTAGGTCGTATGGTTACGATCGAAGATTATGTTGTCTGCGGGTTTCTCCCTCCACCCTCCGAAT

Reverse complement sequence

ATTCGGAGGGTGGAGGGAGAAACCCGCAGACAACATAATCTTCGATCGTAACCATACGACCTAAGATGGGCTGAGGATTAGTACCTCCTGCTTCCCTCTC[T/C,A]
GCCTTTTCACGGCCAGGAAGGGCGCCGTCCTCTTGGAGCTTCTTCAGGGTCGCGCTGGTGGAAGCCGACTTGCCGAGATCCATCGCTGCTGGAAGATCGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.90%	16.00%	18.77%	44.16%	T: 0.19%
All Indica	2759	1.20%	10.40%	22.40%	65.75%	T: 0.25%
All Japonica	1512	61.80%	26.30%	2.18%	9.72%	NA
Aus	269	1.10%	11.20%	75.46%	11.52%	T: 0.74%
Indica I	595	1.00%	2.70%	10.59%	85.71%	NA
Indica II	465	1.50%	12.50%	24.30%	61.72%	NA
Indica III	913	1.00%	15.60%	29.46%	53.56%	T: 0.44%
Indica Intermediate	786	1.50%	8.90%	22.01%	67.18%	T: 0.38%
Temperate Japonica	767	92.40%	0.70%	2.48%	4.43%	NA
Tropical Japonica	504	8.30%	74.40%	0.60%	16.67%	NA
Japonica Intermediate	241	75.90%	7.50%	4.56%	12.03%	NA
VI/Aromatic	96	4.20%	16.70%	15.62%	63.54%	NA
Intermediate	90	15.60%	26.70%	20.00%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519667518	A -> T	LOC_Os05g33480.1	synonymous_variant ; p.Ala28Ala; LOW	synonymous_codon	Average:18.234; most accessible tissue: Callus, score: 34.591	N	N	N	N
vg0519667518	A -> G	LOC_Os05g33480.1	synonymous_variant ; p.Ala28Ala; LOW	synonymous_codon	Average:18.234; most accessible tissue: Callus, score: 34.591	N	N	N	N
vg0519667518	A -> G	LOC_Os05g33480.1	synonymous_variant ; p.Ala28Ala; LOW	nonsynonymous_codon ; A28T	Average:18.234; most accessible tissue: Callus, score: 34.591	unknown	unknown	DELETERIOUS	0.04
vg0519667518	A -> G	LOC_Os05g33480.1	synonymous_variant ; p.Ala28Ala; LOW	nonsynonymous_codon ; A28P	Average:18.234; most accessible tissue: Callus, score: 34.591	unknown	unknown	DELETERIOUS	0.00
vg0519667518	A -> DEL	LOC_Os05g33480.1	N	frameshift_variant	Average:18.234; most accessible tissue: Callus, score: 34.591	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519667518	NA	5.46E-12	mr1089	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	8.86E-12	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.42E-08	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.41E-10	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.54E-10	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	7.27E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	4.46E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	2.98E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.83E-11	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	3.43E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	9.92E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	4.10E-17	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.64E-08	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.15E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	6.37E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.59E-06	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.68E-12	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	7.72E-13	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	5.01E-12	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	7.39E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	3.14E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	3.47E-10	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	4.75E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	2.15E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.47E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	2.12E-09	mr1251_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.13E-07	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	4.30E-06	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.30E-15	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.60E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	2.28E-09	mr1435_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	6.31E-08	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.26E-25	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	6.97E-09	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	7.90E-08	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.02E-16	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.39E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	9.42E-06	mr1781_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	2.56E-10	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	6.00E-11	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	2.85E-08	mr1807_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	1.40E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518	NA	2.87E-07	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251