\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519667518:

Variant ID: vg0519667518 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19667518
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


GCGATCTTCCAGCAGCGATGGATCTCGGCAAGTCGGCTTCCACCAGCGCGACCCTGAAGAAGCTCCAAGAGGACGGCGCCCTTCCTGGCCGTGAAAAGGC[A/G,T]
GAGAGGGAAGCAGGAGGTACTAATCCTCAGCCCATCTTAGGTCGTATGGTTACGATCGAAGATTATGTTGTCTGCGGGTTTCTCCCTCCACCCTCCGAAT

Reverse complement sequence

ATTCGGAGGGTGGAGGGAGAAACCCGCAGACAACATAATCTTCGATCGTAACCATACGACCTAAGATGGGCTGAGGATTAGTACCTCCTGCTTCCCTCTC[T/C,A]
GCCTTTTCACGGCCAGGAAGGGCGCCGTCCTCTTGGAGCTTCTTCAGGGTCGCGCTGGTGGAAGCCGACTTGCCGAGATCCATCGCTGCTGGAAGATCGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.90% 16.00% 18.77% 44.16% T: 0.19%
All Indica  2759 1.20% 10.40% 22.40% 65.75% T: 0.25%
All Japonica  1512 61.80% 26.30% 2.18% 9.72% NA
Aus  269 1.10% 11.20% 75.46% 11.52% T: 0.74%
Indica I  595 1.00% 2.70% 10.59% 85.71% NA
Indica II  465 1.50% 12.50% 24.30% 61.72% NA
Indica III  913 1.00% 15.60% 29.46% 53.56% T: 0.44%
Indica Intermediate  786 1.50% 8.90% 22.01% 67.18% T: 0.38%
Temperate Japonica  767 92.40% 0.70% 2.48% 4.43% NA
Tropical Japonica  504 8.30% 74.40% 0.60% 16.67% NA
Japonica Intermediate  241 75.90% 7.50% 4.56% 12.03% NA
VI/Aromatic  96 4.20% 16.70% 15.62% 63.54% NA
Intermediate  90 15.60% 26.70% 20.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519667518 A -> T LOC_Os05g33480.1 synonymous_variant ; p.Ala28Ala; LOW synonymous_codon Average:18.234; most accessible tissue: Callus, score: 34.591 N N N N
vg0519667518 A -> G LOC_Os05g33480.1 synonymous_variant ; p.Ala28Ala; LOW synonymous_codon Average:18.234; most accessible tissue: Callus, score: 34.591 N N N N
vg0519667518 A -> G LOC_Os05g33480.1 synonymous_variant ; p.Ala28Ala; LOW nonsynonymous_codon ; A28T Average:18.234; most accessible tissue: Callus, score: 34.591 unknown unknown DELETERIOUS 0.04
vg0519667518 A -> G LOC_Os05g33480.1 synonymous_variant ; p.Ala28Ala; LOW nonsynonymous_codon ; A28P Average:18.234; most accessible tissue: Callus, score: 34.591 unknown unknown DELETERIOUS 0.00
vg0519667518 A -> DEL LOC_Os05g33480.1 N frameshift_variant Average:18.234; most accessible tissue: Callus, score: 34.591 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519667518 NA 5.46E-12 mr1089 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 8.86E-12 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.42E-08 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.41E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.54E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 7.27E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 4.46E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 2.98E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.83E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 3.43E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 9.92E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 4.10E-17 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.64E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.15E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 6.37E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.59E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.68E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 7.72E-13 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 5.01E-12 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 7.39E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 3.14E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 3.47E-10 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 4.75E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 2.15E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.47E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 2.12E-09 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.13E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 4.30E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.30E-15 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.60E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 2.28E-09 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 6.31E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.26E-25 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 6.97E-09 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 7.90E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.02E-16 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.39E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 9.42E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 2.56E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 6.00E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 2.85E-08 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 1.40E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519667518 NA 2.87E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251