\
| Variant ID: vg0519574200 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19574200 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTAGCTCGAAGAGGGCCTCCCACCATGGGTTCCGAACCATCTTGGGAAACATGTGACCACTTAGCAAACGAGGTCAGGTTCCCACGAGCCTGTGTCCCCA[C/T]
GCTACACATTCTGTTTGCTCTTTCCTTTCAGTGGCCTCCTTCCAATCTCTTTTCCTTCTACATGGACGATTACTTTCGCACGAGTGTGAGAGCCGAAAAC
GTTTTCGGCTCTCACACTCGTGCGAAAGTAATCGTCCATGTAGAAGGAAAAGAGATTGGAAGGAGGCCACTGAAAGGAAAGAGCAAACAGAATGTGTAGC[G/A]
TGGGGACACAGGCTCGTGGGAACCTGACCTCGTTTGCTAAGTGGTCACATGTTTCCCAAGATGGTTCGGAACCCATGGTGGGAGGCCCTCTTCGAGCTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.50% | 6.40% | 9.52% | 6.62% | NA |
| All Indica | 2759 | 81.30% | 5.80% | 11.74% | 1.20% | NA |
| All Japonica | 1512 | 73.40% | 5.40% | 4.76% | 16.47% | NA |
| Aus | 269 | 76.60% | 15.60% | 6.69% | 1.12% | NA |
| Indica I | 595 | 79.80% | 3.40% | 15.46% | 1.34% | NA |
| Indica II | 465 | 84.30% | 9.00% | 6.45% | 0.22% | NA |
| Indica III | 913 | 78.10% | 6.70% | 14.13% | 1.10% | NA |
| Indica Intermediate | 786 | 84.20% | 4.70% | 9.29% | 1.78% | NA |
| Temperate Japonica | 767 | 98.40% | 0.00% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 31.00% | 15.30% | 13.29% | 40.48% | NA |
| Japonica Intermediate | 241 | 82.60% | 1.70% | 1.66% | 14.11% | NA |
| VI/Aromatic | 96 | 31.20% | 15.60% | 26.04% | 27.08% | NA |
| Intermediate | 90 | 82.20% | 3.30% | 12.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519574200 | C -> T | LOC_Os05g33340.1 | upstream_gene_variant ; 4996.0bp to feature; MODIFIER | silent_mutation | Average:13.928; most accessible tissue: Callus, score: 37.013 | N | N | N | N |
| vg0519574200 | C -> T | LOC_Os05g33340-LOC_Os05g33350 | intergenic_region ; MODIFIER | silent_mutation | Average:13.928; most accessible tissue: Callus, score: 37.013 | N | N | N | N |
| vg0519574200 | C -> DEL | N | N | silent_mutation | Average:13.928; most accessible tissue: Callus, score: 37.013 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519574200 | NA | 7.17E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574200 | NA | 6.16E-08 | mr1049_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574200 | NA | 8.57E-06 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574200 | NA | 6.48E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574200 | 3.91E-06 | 3.91E-06 | mr1981_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |