| Variant ID: vg0519574036 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19574036 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, A: 0.43, others allele: 0.00, population size: 94. )
CCAGCCGACGGGGCCAAAGCCAGCCGCTACGGAAGAGCTAGCACAGGGGGCCCCGGGCGTCGACGGTACCCAGAGCTCGACGCAGGGCTAGGATAGAGCT[T/A]
GGAATCATAACCCCCACACTTATAGCAAAGAATTGCATGTATGAATGAAGCAAACACAAACCTTTAGCTCGAAGAGGGCCTCCCACCATGGGTTCCGAAC
GTTCGGAACCCATGGTGGGAGGCCCTCTTCGAGCTAAAGGTTTGTGTTTGCTTCATTCATACATGCAATTCTTTGCTATAAGTGTGGGGGTTATGATTCC[A/T]
AGCTCTATCCTAGCCCTGCGTCGAGCTCTGGGTACCGTCGACGCCCGGGGCCCCCTGTGCTAGCTCTTCCGTAGCGGCTGGCTTTGGCCCCGTCGGCTGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 23.50% | 21.20% | 19.47% | 35.89% | NA |
| All Indica | 2759 | 37.00% | 1.20% | 17.40% | 44.44% | NA |
| All Japonica | 1512 | 2.10% | 63.00% | 10.71% | 24.27% | NA |
| Aus | 269 | 10.40% | 0.40% | 77.32% | 11.90% | NA |
| Indica I | 595 | 19.30% | 0.70% | 5.71% | 74.29% | NA |
| Indica II | 465 | 44.90% | 1.10% | 29.46% | 24.52% | NA |
| Indica III | 913 | 37.90% | 1.30% | 19.39% | 41.40% | NA |
| Indica Intermediate | 786 | 44.70% | 1.40% | 16.79% | 37.15% | NA |
| Temperate Japonica | 767 | 3.10% | 94.40% | 0.00% | 2.48% | NA |
| Tropical Japonica | 504 | 1.00% | 8.50% | 29.37% | 61.11% | NA |
| Japonica Intermediate | 241 | 0.80% | 76.80% | 5.81% | 16.60% | NA |
| VI/Aromatic | 96 | 1.00% | 3.10% | 46.88% | 48.96% | NA |
| Intermediate | 90 | 31.10% | 14.40% | 27.78% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519574036 | T -> DEL | N | N | silent_mutation | Average:13.448; most accessible tissue: Callus, score: 25.308 | N | N | N | N |
| vg0519574036 | T -> A | LOC_Os05g33340.1 | upstream_gene_variant ; 4832.0bp to feature; MODIFIER | silent_mutation | Average:13.448; most accessible tissue: Callus, score: 25.308 | N | N | N | N |
| vg0519574036 | T -> A | LOC_Os05g33340-LOC_Os05g33350 | intergenic_region ; MODIFIER | silent_mutation | Average:13.448; most accessible tissue: Callus, score: 25.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519574036 | NA | 5.97E-35 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0519574036 | NA | 9.39E-10 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574036 | NA | 2.98E-10 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574036 | NA | 1.68E-07 | mr1129 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574036 | NA | 1.14E-10 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574036 | NA | 2.57E-10 | mr1251 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574036 | NA | 8.71E-08 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574036 | NA | 1.70E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574036 | NA | 4.45E-08 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519574036 | NA | 3.18E-11 | mr1435 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/