\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519509643:

Variant ID: vg0519509643 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19509643
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTCGTTCGGTTTTGAAAATACAGAAGGAGATGTATAAGAACTTTCTTTAAAAAAACTCACATGCTAACTTGAGATGATCGGACTCATAATTATAGCT[C/T]
ATGATTTTCTAGAAAAATATATATCTAAACGAATACTACAGTGAATTTTACCTTAACTAAACCGTAAAATAATAATAATAAGATTAAAATAATCTTCACC

Reverse complement sequence

GGTGAAGATTATTTTAATCTTATTATTATTATTTTACGGTTTAGTTAAGGTAAAATTCACTGTAGTATTCGTTTAGATATATATTTTTCTAGAAAATCAT[G/A]
AGCTATAATTATGAGTCCGATCATCTCAAGTTAGCATGTGAGTTTTTTTAAAGAAAGTTCTTATACATCTCCTTCTGTATTTTCAAAACCGAACGAATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 33.00% 0.23% 0.19% NA
All Indica  2759 63.30% 36.10% 0.29% 0.33% NA
All Japonica  1512 66.60% 33.30% 0.07% 0.00% NA
Aus  269 90.70% 9.30% 0.00% 0.00% NA
Indica I  595 81.20% 18.50% 0.00% 0.34% NA
Indica II  465 55.50% 43.70% 0.86% 0.00% NA
Indica III  913 62.30% 37.00% 0.22% 0.44% NA
Indica Intermediate  786 55.60% 43.80% 0.25% 0.38% NA
Temperate Japonica  767 60.60% 39.40% 0.00% 0.00% NA
Tropical Japonica  504 91.50% 8.50% 0.00% 0.00% NA
Japonica Intermediate  241 33.60% 66.00% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519509643 C -> T LOC_Os05g33280.1 upstream_gene_variant ; 552.0bp to feature; MODIFIER silent_mutation Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0519509643 C -> T LOC_Os05g33300.1 upstream_gene_variant ; 4659.0bp to feature; MODIFIER silent_mutation Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0519509643 C -> T LOC_Os05g33270.1 downstream_gene_variant ; 2243.0bp to feature; MODIFIER silent_mutation Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0519509643 C -> T LOC_Os05g33290.1 downstream_gene_variant ; 330.0bp to feature; MODIFIER silent_mutation Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0519509643 C -> T LOC_Os05g33280-LOC_Os05g33290 intergenic_region ; MODIFIER silent_mutation Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0519509643 C -> DEL N N silent_mutation Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519509643 NA 5.68E-06 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519509643 NA 5.57E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519509643 9.13E-06 NA mr1740 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519509643 NA 7.47E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519509643 NA 2.62E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251