Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0519509643:

Variant ID: vg0519509643 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19509643
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

AAATTCGTTCGGTTTTGAAAATACAGAAGGAGATGTATAAGAACTTTCTTTAAAAAAACTCACATGCTAACTTGAGATGATCGGACTCATAATTATAGCT[C/T]
ATGATTTTCTAGAAAAATATATATCTAAACGAATACTACAGTGAATTTTACCTTAACTAAACCGTAAAATAATAATAATAAGATTAAAATAATCTTCACC

Reverse complement sequence

GGTGAAGATTATTTTAATCTTATTATTATTATTTTACGGTTTAGTTAAGGTAAAATTCACTGTAGTATTCGTTTAGATATATATTTTTCTAGAAAATCAT[G/A]
AGCTATAATTATGAGTCCGATCATCTCAAGTTAGCATGTGAGTTTTTTTAAAGAAAGTTCTTATACATCTCCTTCTGTATTTTCAAAACCGAACGAATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.60%	33.00%	0.23%	0.19%	NA
All Indica	2759	63.30%	36.10%	0.29%	0.33%	NA
All Japonica	1512	66.60%	33.30%	0.07%	0.00%	NA
Aus	269	90.70%	9.30%	0.00%	0.00%	NA
Indica I	595	81.20%	18.50%	0.00%	0.34%	NA
Indica II	465	55.50%	43.70%	0.86%	0.00%	NA
Indica III	913	62.30%	37.00%	0.22%	0.44%	NA
Indica Intermediate	786	55.60%	43.80%	0.25%	0.38%	NA
Temperate Japonica	767	60.60%	39.40%	0.00%	0.00%	NA
Tropical Japonica	504	91.50%	8.50%	0.00%	0.00%	NA
Japonica Intermediate	241	33.60%	66.00%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	63.30%	35.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519509643	C -> T	LOC_Os05g33280.1	upstream_gene_variant ; 552.0bp to feature; MODIFIER	silent_mutation	Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0519509643	C -> T	LOC_Os05g33300.1	upstream_gene_variant ; 4659.0bp to feature; MODIFIER	silent_mutation	Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0519509643	C -> T	LOC_Os05g33270.1	downstream_gene_variant ; 2243.0bp to feature; MODIFIER	silent_mutation	Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0519509643	C -> T	LOC_Os05g33290.1	downstream_gene_variant ; 330.0bp to feature; MODIFIER	silent_mutation	Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0519509643	C -> T	LOC_Os05g33280-LOC_Os05g33290	intergenic_region ; MODIFIER	silent_mutation	Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0519509643	C -> DEL	N	N	silent_mutation	Average:44.769; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519509643	NA	5.68E-06	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519509643	NA	5.57E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519509643	9.13E-06	NA	mr1740	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519509643	NA	7.47E-06	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519509643	NA	2.62E-07	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251