\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519502040:

Variant ID: vg0519502040 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19502040
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATAAACTTTATATGAAATATGATACATTATAATATTACAAATTTAAATAAATCTCTTTATGGTGCTATATTTTATAGCTGTATCATGGAGCCTGAGAA[C/T]
GCATGACACGACAAGGCAACCGAATCCGTACGGGAAAATGCAACGAATAGGCAGGCATTGACGAAAGCAAAATTAAAAAAAATTATCACCTGGTCCCGAT

Reverse complement sequence

ATCGGGACCAGGTGATAATTTTTTTTAATTTTGCTTTCGTCAATGCCTGCCTATTCGTTGCATTTTCCCGTACGGATTCGGTTGCCTTGTCGTGTCATGC[G/A]
TTCTCAGGCTCCATGATACAGCTATAAAATATAGCACCATAAAGAGATTTATTTAAATTTGTAATATTATAATGTATCATATTTCATATAAAGTTTATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 4.00% 0.70% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 85.40% 12.40% 2.18% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 82.80% 14.10% 3.13% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 73.40% 22.80% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519502040 C -> T LOC_Os05g33270.1 upstream_gene_variant ; 884.0bp to feature; MODIFIER silent_mutation Average:64.187; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0519502040 C -> T LOC_Os05g33260.2 downstream_gene_variant ; 4462.0bp to feature; MODIFIER silent_mutation Average:64.187; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0519502040 C -> T LOC_Os05g33260.3 downstream_gene_variant ; 4440.0bp to feature; MODIFIER silent_mutation Average:64.187; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0519502040 C -> T LOC_Os05g33260-LOC_Os05g33270 intergenic_region ; MODIFIER silent_mutation Average:64.187; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519502040 NA 4.47E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519502040 2.63E-06 3.96E-11 mr1691_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519502040 NA 2.12E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519502040 2.17E-06 NA mr1720_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251