\
| Variant ID: vg0519502040 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19502040 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAATAAACTTTATATGAAATATGATACATTATAATATTACAAATTTAAATAAATCTCTTTATGGTGCTATATTTTATAGCTGTATCATGGAGCCTGAGAA[C/T]
GCATGACACGACAAGGCAACCGAATCCGTACGGGAAAATGCAACGAATAGGCAGGCATTGACGAAAGCAAAATTAAAAAAAATTATCACCTGGTCCCGAT
ATCGGGACCAGGTGATAATTTTTTTTAATTTTGCTTTCGTCAATGCCTGCCTATTCGTTGCATTTTCCCGTACGGATTCGGTTGCCTTGTCGTGTCATGC[G/A]
TTCTCAGGCTCCATGATACAGCTATAAAATATAGCACCATAAAGAGATTTATTTAAATTTGTAATATTATAATGTATCATATTTCATATAAAGTTTATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.30% | 4.00% | 0.70% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 85.40% | 12.40% | 2.18% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 82.80% | 14.10% | 3.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 22.80% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519502040 | C -> T | LOC_Os05g33270.1 | upstream_gene_variant ; 884.0bp to feature; MODIFIER | silent_mutation | Average:64.187; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0519502040 | C -> T | LOC_Os05g33260.2 | downstream_gene_variant ; 4462.0bp to feature; MODIFIER | silent_mutation | Average:64.187; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0519502040 | C -> T | LOC_Os05g33260.3 | downstream_gene_variant ; 4440.0bp to feature; MODIFIER | silent_mutation | Average:64.187; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0519502040 | C -> T | LOC_Os05g33260-LOC_Os05g33270 | intergenic_region ; MODIFIER | silent_mutation | Average:64.187; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519502040 | NA | 4.47E-10 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519502040 | 2.63E-06 | 3.96E-11 | mr1691_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519502040 | NA | 2.12E-06 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519502040 | 2.17E-06 | NA | mr1720_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |