RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0519489555:

Variant ID: vg0519489555 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19489555
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, T: 0.13, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

ACATTACATTCCCCAGCATTTCTTTTTAAGTCAGACATATCACCAATAAGCATAAATAAACAGGAAAAAAAATCATAACCTGTCAACAGTTGTCAATGTT[T/A]
ATAGAGGACAAGACATAAGAAGTAACTGTAGAAAAGAAGCATACCGATCCATCAGAAGTAGTATAATTTGGCACATCCCCAGATTGGAACTCCATATCAT

Reverse complement sequence

ATGATATGGAGTTCCAATCTGGGGATGTGCCAAATTATACTACTTCTGATGGATCGGTATGCTTCTTTTCTACAGTTACTTCTTATGTCTTGTCCTCTAT[A/T]
AACATTGACAACTGTTGACAGGTTATGATTTTTTTTCCTGTTTATTTATGCTTATTGGTGATATGTCTGACTTAAAAAGAAATGCTGGGGAATGTAATGT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.20%	20.80%	0.00%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	37.30%	62.70%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	5.90%	94.10%	0.00%	0.00%	NA
Tropical Japonica	504	91.90%	8.10%	0.00%	0.00%	NA
Japonica Intermediate	241	23.20%	76.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519489555	T -> A	LOC_Os05g33260.2	upstream_gene_variant ; 1122.0bp to feature; MODIFIER	silent_mutation	Average:59.375; most accessible tissue: Callus, score: 81.612	N	N	N	N
vg0519489555	T -> A	LOC_Os05g33260.3	upstream_gene_variant ; 1122.0bp to feature; MODIFIER	silent_mutation	Average:59.375; most accessible tissue: Callus, score: 81.612	N	N	N	N
vg0519489555	T -> A	LOC_Os05g33230.1	downstream_gene_variant ; 827.0bp to feature; MODIFIER	silent_mutation	Average:59.375; most accessible tissue: Callus, score: 81.612	N	N	N	N
vg0519489555	T -> A	LOC_Os05g33240.1	intron_variant ; MODIFIER	silent_mutation	Average:59.375; most accessible tissue: Callus, score: 81.612	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519489555	NA	2.12E-35	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0519489555	NA	1.72E-55	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0519489555	NA	7.82E-11	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519489555	NA	6.23E-41	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519489555	NA	1.40E-10	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519489555	NA	3.37E-08	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519489555	NA	1.23E-09	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519489555	NA	4.04E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519489555	NA	6.58E-85	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519489555	NA	5.83E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 64 entries

Previous1 2 3 4 5 6 7Next

Search for Variation information by Variation ID:

Detailed information for vg0519489555:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact