| Variant ID: vg0519486642 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19486642 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, C: 0.10, others allele: 0.00, population size: 186. )
GAAGTTATAATTAATGCACTATTGTGAAAAAAAAAAACAATTTATTGAACATTGGCATAAGCTACTCACGTTATATTGAGCTATTAACTAATTAGAATTT[C/T]
CTATGGATATCCCGACTCTCATTTAGTGTAATTCAAAACTTTTAAATAGAAAACCTTCATTGACCATTTGGGAAATTCTGAAATGTCAACTCAGTGATAT
ATATCACTGAGTTGACATTTCAGAATTTCCCAAATGGTCAATGAAGGTTTTCTATTTAAAAGTTTTGAATTACACTAAATGAGAGTCGGGATATCCATAG[G/A]
AAATTCTAATTAGTTAATAGCTCAATATAACGTGAGTAGCTTATGCCAATGTTCAATAAATTGTTTTTTTTTTTCACAATAGTGCATTAATTATAACTTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 37.20% | 62.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 5.70% | 94.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 23.20% | 76.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519486642 | C -> T | LOC_Os05g33260.2 | upstream_gene_variant ; 4035.0bp to feature; MODIFIER | silent_mutation | Average:41.059; most accessible tissue: Callus, score: 62.893 | N | N | N | N |
| vg0519486642 | C -> T | LOC_Os05g33260.3 | upstream_gene_variant ; 4035.0bp to feature; MODIFIER | silent_mutation | Average:41.059; most accessible tissue: Callus, score: 62.893 | N | N | N | N |
| vg0519486642 | C -> T | LOC_Os05g33220.1 | downstream_gene_variant ; 4462.0bp to feature; MODIFIER | silent_mutation | Average:41.059; most accessible tissue: Callus, score: 62.893 | N | N | N | N |
| vg0519486642 | C -> T | LOC_Os05g33240.1 | downstream_gene_variant ; 1712.0bp to feature; MODIFIER | silent_mutation | Average:41.059; most accessible tissue: Callus, score: 62.893 | N | N | N | N |
| vg0519486642 | C -> T | LOC_Os05g33230.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.059; most accessible tissue: Callus, score: 62.893 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519486642 | NA | 2.62E-36 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0519486642 | NA | 6.58E-56 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0519486642 | NA | 6.11E-42 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519486642 | NA | 1.96E-11 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519486642 | NA | 3.77E-44 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519486642 | NA | 3.75E-12 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519486642 | NA | 6.62E-09 | mr1129 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519486642 | NA | 2.23E-40 | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519486642 | NA | 1.13E-11 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519486642 | NA | 1.48E-11 | mr1251 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/