\
| Variant ID: vg0519469410 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19469410 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGTACATATGTAGAACTATTATCCAATGGATAACTTTATCATTCTTAAGAAAGTATCAGAAGGACTATAGTATAAAACATAGTACTACTAAACAAATTAG[T/C]
ATAAAATCTAGTTACTTTCTCAATAAACTGTAAAATTTCTTATATCGAATACATATGCCATGTTTTAGAAGTATGAAGTAACAACACCATAATAAGTTGT
ACAACTTATTATGGTGTTGTTACTTCATACTTCTAAAACATGGCATATGTATTCGATATAAGAAATTTTACAGTTTATTGAGAAAGTAACTAGATTTTAT[A/G]
CTAATTTGTTTAGTAGTACTATGTTTTATACTATAGTCCTTCTGATACTTTCTTAAGAATGATAAAGTTATCCATTGGATAATAGTTCTACATATGTACC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 7.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.20% | 20.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519469410 | T -> C | LOC_Os05g33200.1 | upstream_gene_variant ; 816.0bp to feature; MODIFIER | silent_mutation | Average:36.976; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0519469410 | T -> C | LOC_Os05g33190.1 | downstream_gene_variant ; 1503.0bp to feature; MODIFIER | silent_mutation | Average:36.976; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0519469410 | T -> C | LOC_Os05g33190-LOC_Os05g33200 | intergenic_region ; MODIFIER | silent_mutation | Average:36.976; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519469410 | NA | 9.14E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519469410 | 1.13E-07 | NA | mr1301 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519469410 | 3.79E-06 | NA | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519469410 | 5.14E-07 | NA | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519469410 | 2.53E-06 | NA | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |