Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519461555:

Variant ID: vg0519461555 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19461555
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, A: 0.31, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:

GGCACGCTTAGAGGTCATTAATAGGGCTTAATTTTCACTGTTTGTTGAGTTGTCCCGTTTCGCGTGTAGTTTCGGAGCCCGAAGACCCGTAGTGCGAGGA[A/T]
TTCGAGGATCAAGCTCAAGATCTCGAGCAAGGCAAGCCACCTTTGAACATATTGAGCCTATATTTGAACTTAATTATATTGCTTGCAAAATATCATGCAT

Reverse complement sequence

ATGCATGATATTTTGCAAGCAATATAATTAAGTTCAAATATAGGCTCAATATGTTCAAAGGTGGCTTGCCTTGCTCGAGATCTTGAGCTTGATCCTCGAA[T/A]
TCCTCGCACTACGGGTCTTCGGGCTCCGAAACTACACGCGAAACGGGACAACTCAACAAACAGTGAAAATTAAGCCCTATTAATGACCTCTAAGCGTGCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.40%	22.70%	32.12%	11.85%	NA
All Indica	2759	51.40%	2.00%	39.14%	7.50%	NA
All Japonica	1512	3.60%	63.60%	13.10%	19.71%	NA
Aus	269	27.90%	11.50%	60.22%	0.37%	NA
Indica I	595	53.30%	0.50%	36.30%	9.92%	NA
Indica II	465	35.70%	1.70%	50.54%	12.04%	NA
Indica III	913	61.10%	1.60%	33.19%	4.05%	NA
Indica Intermediate	786	48.00%	3.60%	41.48%	7.00%	NA
Temperate Japonica	767	1.00%	94.40%	2.22%	2.35%	NA
Tropical Japonica	504	9.10%	10.10%	32.54%	48.21%	NA
Japonica Intermediate	241	0.00%	77.60%	7.05%	15.35%	NA
VI/Aromatic	96	7.30%	4.20%	43.75%	44.79%	NA
Intermediate	90	25.60%	22.20%	40.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519461555	A -> T	LOC_Os05g33180.1	upstream_gene_variant ; 4648.0bp to feature; MODIFIER	silent_mutation	Average:8.965; most accessible tissue: Callus, score: 31.665	N	N	N	N
vg0519461555	A -> T	LOC_Os05g33190.1	upstream_gene_variant ; 3578.0bp to feature; MODIFIER	silent_mutation	Average:8.965; most accessible tissue: Callus, score: 31.665	N	N	N	N
vg0519461555	A -> T	LOC_Os05g33180-LOC_Os05g33190	intergenic_region ; MODIFIER	silent_mutation	Average:8.965; most accessible tissue: Callus, score: 31.665	N	N	N	N
vg0519461555	A -> DEL	N	N	silent_mutation	Average:8.965; most accessible tissue: Callus, score: 31.665	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519461555	NA	1.39E-08	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519461555	NA	1.13E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519461555	NA	5.27E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519461555	NA	2.64E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519461555	2.79E-08	NA	mr1745_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519461555	1.12E-06	NA	mr1745_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251