| Variant ID: vg0519456069 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19456069 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACATGGTCTTTCGTCTCTAAAGGATCCGACAAGGCCTTATCGGCTCTGGGCGTCCCTAGCCGAAGTTCCCTTAGGTTCCTCGGAGGCCTTGTCAAGACGG[C/T]
GTAAAGGGACATTAGGATAGGTTTCAACGCTAGGTGTCATCTGGGTAAGGGATCTCTGGGTAAAACACTTGGTGATCTTGTGCTCCTGATATCAACTTTG
CAAAGTTGATATCAGGAGCACAAGATCACCAAGTGTTTTACCCAGAGATCCCTTACCCAGATGACACCTAGCGTTGAAACCTATCCTAATGTCCCTTTAC[G/A]
CCGTCTTGACAAGGCCTCCGAGGAACCTAAGGGAACTTCGGCTAGGGACGCCCAGAGCCGATAAGGCCTTGTCGGATCCTTTAGAGACGAAAGACCATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.60% | 0.30% | 8.42% | 32.71% | NA |
| All Indica | 2759 | 52.90% | 0.00% | 5.07% | 42.01% | NA |
| All Japonica | 1512 | 68.40% | 0.70% | 13.82% | 17.13% | NA |
| Aus | 269 | 72.50% | 0.00% | 5.20% | 22.30% | NA |
| Indica I | 595 | 36.00% | 0.00% | 3.36% | 60.67% | NA |
| Indica II | 465 | 44.70% | 0.00% | 6.45% | 48.82% | NA |
| Indica III | 913 | 70.60% | 0.10% | 5.59% | 23.66% | NA |
| Indica Intermediate | 786 | 49.90% | 0.00% | 4.96% | 45.17% | NA |
| Temperate Japonica | 767 | 95.20% | 0.00% | 0.52% | 4.30% | NA |
| Tropical Japonica | 504 | 22.00% | 2.00% | 38.10% | 37.90% | NA |
| Japonica Intermediate | 241 | 80.10% | 0.00% | 5.39% | 14.52% | NA |
| VI/Aromatic | 96 | 29.20% | 1.00% | 31.25% | 38.54% | NA |
| Intermediate | 90 | 60.00% | 0.00% | 5.56% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519456069 | C -> T | LOC_Os05g33170.1 | upstream_gene_variant ; 2293.0bp to feature; MODIFIER | silent_mutation | Average:11.381; most accessible tissue: Callus, score: 23.549 | N | N | N | N |
| vg0519456069 | C -> T | LOC_Os05g33180.1 | downstream_gene_variant ; 30.0bp to feature; MODIFIER | silent_mutation | Average:11.381; most accessible tissue: Callus, score: 23.549 | N | N | N | N |
| vg0519456069 | C -> T | LOC_Os05g33170-LOC_Os05g33180 | intergenic_region ; MODIFIER | silent_mutation | Average:11.381; most accessible tissue: Callus, score: 23.549 | N | N | N | N |
| vg0519456069 | C -> DEL | N | N | silent_mutation | Average:11.381; most accessible tissue: Callus, score: 23.549 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519456069 | NA | 1.51E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519456069 | NA | 2.29E-06 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519456069 | NA | 4.40E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519456069 | 2.35E-06 | NA | mr1731 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519456069 | NA | 4.27E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519456069 | 6.83E-06 | 6.83E-06 | mr1803 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519456069 | NA | 2.28E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519456069 | NA | 9.33E-06 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519456069 | NA | 2.18E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |