\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519441155:

Variant ID: vg0519441155 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19441155
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGTTTGTCAAAAAAAACTCTCTCCTATCATTTTGACCACAGAAACCTTATCTCCTCGGCTTTTCTCGTCTCGTTCTCTTCTCCCTAAATCGCATCGCT[C/A]
TCTCTTCCCCCAAATCACGCCCAGATGCGACCTCCTGCCTCCACGCCTTCCTCCCCGCAAATCCCTCCCCTCTCCACGCCGCTCCCCCTCACTCCCTCCC

Reverse complement sequence

GGGAGGGAGTGAGGGGGAGCGGCGTGGAGAGGGGAGGGATTTGCGGGGAGGAAGGCGTGGAGGCAGGAGGTCGCATCTGGGCGTGATTTGGGGGAAGAGA[G/T]
AGCGATGCGATTTAGGGAGAAGAGAACGAGACGAGAAAAGCCGAGGAGATAAGGTTTCTGTGGTCAAAATGATAGGAGAGAGTTTTTTTTGACAAACCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 26.00% 13.33% 0.40% NA
All Indica  2759 51.10% 37.50% 10.69% 0.65% NA
All Japonica  1512 86.20% 6.30% 7.34% 0.07% NA
Aus  269 23.00% 5.60% 71.38% 0.00% NA
Indica I  595 25.70% 64.00% 8.40% 1.85% NA
Indica II  465 59.40% 17.20% 23.23% 0.22% NA
Indica III  913 55.30% 38.80% 5.70% 0.22% NA
Indica Intermediate  786 60.70% 28.00% 10.81% 0.51% NA
Temperate Japonica  767 98.70% 0.10% 1.17% 0.00% NA
Tropical Japonica  504 68.30% 15.70% 15.87% 0.20% NA
Japonica Intermediate  241 84.20% 6.60% 9.13% 0.00% NA
VI/Aromatic  96 8.30% 72.90% 18.75% 0.00% NA
Intermediate  90 71.10% 13.30% 15.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519441155 C -> DEL N N silent_mutation Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0519441155 C -> A LOC_Os05g33150.1 upstream_gene_variant ; 4743.0bp to feature; MODIFIER silent_mutation Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0519441155 C -> A LOC_Os05g33140.1 downstream_gene_variant ; 4421.0bp to feature; MODIFIER silent_mutation Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0519441155 C -> A LOC_Os05g33140-LOC_Os05g33150 intergenic_region ; MODIFIER silent_mutation Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519441155 NA 3.92E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155 NA 3.52E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155 NA 3.83E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155 NA 4.59E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155 NA 2.61E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155 NA 2.21E-06 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155 NA 2.07E-06 mr1333_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155 3.75E-06 NA mr1363_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155 NA 4.96E-06 mr1363_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251