\
| Variant ID: vg0519441155 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19441155 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )
GAGGTTTGTCAAAAAAAACTCTCTCCTATCATTTTGACCACAGAAACCTTATCTCCTCGGCTTTTCTCGTCTCGTTCTCTTCTCCCTAAATCGCATCGCT[C/A]
TCTCTTCCCCCAAATCACGCCCAGATGCGACCTCCTGCCTCCACGCCTTCCTCCCCGCAAATCCCTCCCCTCTCCACGCCGCTCCCCCTCACTCCCTCCC
GGGAGGGAGTGAGGGGGAGCGGCGTGGAGAGGGGAGGGATTTGCGGGGAGGAAGGCGTGGAGGCAGGAGGTCGCATCTGGGCGTGATTTGGGGGAAGAGA[G/T]
AGCGATGCGATTTAGGGAGAAGAGAACGAGACGAGAAAAGCCGAGGAGATAAGGTTTCTGTGGTCAAAATGATAGGAGAGAGTTTTTTTTGACAAACCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.30% | 26.00% | 13.33% | 0.40% | NA |
| All Indica | 2759 | 51.10% | 37.50% | 10.69% | 0.65% | NA |
| All Japonica | 1512 | 86.20% | 6.30% | 7.34% | 0.07% | NA |
| Aus | 269 | 23.00% | 5.60% | 71.38% | 0.00% | NA |
| Indica I | 595 | 25.70% | 64.00% | 8.40% | 1.85% | NA |
| Indica II | 465 | 59.40% | 17.20% | 23.23% | 0.22% | NA |
| Indica III | 913 | 55.30% | 38.80% | 5.70% | 0.22% | NA |
| Indica Intermediate | 786 | 60.70% | 28.00% | 10.81% | 0.51% | NA |
| Temperate Japonica | 767 | 98.70% | 0.10% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 68.30% | 15.70% | 15.87% | 0.20% | NA |
| Japonica Intermediate | 241 | 84.20% | 6.60% | 9.13% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 72.90% | 18.75% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 13.30% | 15.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519441155 | C -> DEL | N | N | silent_mutation | Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0519441155 | C -> A | LOC_Os05g33150.1 | upstream_gene_variant ; 4743.0bp to feature; MODIFIER | silent_mutation | Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0519441155 | C -> A | LOC_Os05g33140.1 | downstream_gene_variant ; 4421.0bp to feature; MODIFIER | silent_mutation | Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0519441155 | C -> A | LOC_Os05g33140-LOC_Os05g33150 | intergenic_region ; MODIFIER | silent_mutation | Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519441155 | NA | 3.92E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519441155 | NA | 3.52E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519441155 | NA | 3.83E-07 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519441155 | NA | 4.59E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519441155 | NA | 2.61E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519441155 | NA | 2.21E-06 | mr1325_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519441155 | NA | 2.07E-06 | mr1333_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519441155 | 3.75E-06 | NA | mr1363_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519441155 | NA | 4.96E-06 | mr1363_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |