Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519441155:

Variant ID: vg0519441155 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19441155
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

GAGGTTTGTCAAAAAAAACTCTCTCCTATCATTTTGACCACAGAAACCTTATCTCCTCGGCTTTTCTCGTCTCGTTCTCTTCTCCCTAAATCGCATCGCT[C/A]
TCTCTTCCCCCAAATCACGCCCAGATGCGACCTCCTGCCTCCACGCCTTCCTCCCCGCAAATCCCTCCCCTCTCCACGCCGCTCCCCCTCACTCCCTCCC

Reverse complement sequence

GGGAGGGAGTGAGGGGGAGCGGCGTGGAGAGGGGAGGGATTTGCGGGGAGGAAGGCGTGGAGGCAGGAGGTCGCATCTGGGCGTGATTTGGGGGAAGAGA[G/T]
AGCGATGCGATTTAGGGAGAAGAGAACGAGACGAGAAAAGCCGAGGAGATAAGGTTTCTGTGGTCAAAATGATAGGAGAGAGTTTTTTTTGACAAACCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	26.00%	13.33%	0.40%	NA
All Indica	2759	51.10%	37.50%	10.69%	0.65%	NA
All Japonica	1512	86.20%	6.30%	7.34%	0.07%	NA
Aus	269	23.00%	5.60%	71.38%	0.00%	NA
Indica I	595	25.70%	64.00%	8.40%	1.85%	NA
Indica II	465	59.40%	17.20%	23.23%	0.22%	NA
Indica III	913	55.30%	38.80%	5.70%	0.22%	NA
Indica Intermediate	786	60.70%	28.00%	10.81%	0.51%	NA
Temperate Japonica	767	98.70%	0.10%	1.17%	0.00%	NA
Tropical Japonica	504	68.30%	15.70%	15.87%	0.20%	NA
Japonica Intermediate	241	84.20%	6.60%	9.13%	0.00%	NA
VI/Aromatic	96	8.30%	72.90%	18.75%	0.00%	NA
Intermediate	90	71.10%	13.30%	15.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519441155	C -> DEL	N	N	silent_mutation	Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N
vg0519441155	C -> A	LOC_Os05g33150.1	upstream_gene_variant ; 4743.0bp to feature; MODIFIER	silent_mutation	Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N
vg0519441155	C -> A	LOC_Os05g33140.1	downstream_gene_variant ; 4421.0bp to feature; MODIFIER	silent_mutation	Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N
vg0519441155	C -> A	LOC_Os05g33140-LOC_Os05g33150	intergenic_region ; MODIFIER	silent_mutation	Average:71.631; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519441155	NA	3.92E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155	NA	3.52E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155	NA	3.83E-07	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155	NA	4.59E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155	NA	2.61E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155	NA	2.21E-06	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155	NA	2.07E-06	mr1333_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155	3.75E-06	NA	mr1363_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519441155	NA	4.96E-06	mr1363_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251