Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0519414866:

Variant ID: vg0519414866 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19414866
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGTCGGTGAGACTTATGGAGAGTAAAAGTAAACCCCAATGATTATCATGTTCGATTTTTATAATCTCAATGACAATAAGGAGGGGAGGCAGTAGGCGGG[C/T]
TGTAGAGAAGTATAGTGGCGAAGCCACTAACGATTTGGCGAGACTTATAGAAAGTAAAAAAAGAATACAAACAATAATTATGTTCAATTTTTAAAATCCC

Reverse complement sequence

GGGATTTTAAAAATTGAACATAATTATTGTTTGTATTCTTTTTTTACTTTCTATAAGTCTCGCCAAATCGTTAGTGGCTTCGCCACTATACTTCTCTACA[G/A]
CCCGCCTACTGCCTCCCCTCCTTATTGTCATTGAGATTATAAAAATCGAACATGATAATCATTGGGGTTTACTTTTACTCTCCATAAGTCTCACCGACCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	9.20%	0.23%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	70.70%	28.60%	0.73%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	66.20%	32.50%	1.30%	0.00%	NA
Tropical Japonica	504	84.90%	15.10%	0.00%	0.00%	NA
Japonica Intermediate	241	55.20%	44.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519414866	C -> T	LOC_Os05g33110.1	upstream_gene_variant ; 523.0bp to feature; MODIFIER	silent_mutation	Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0519414866	C -> T	LOC_Os05g33110.2	upstream_gene_variant ; 523.0bp to feature; MODIFIER	silent_mutation	Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0519414866	C -> T	LOC_Os05g33110.3	upstream_gene_variant ; 523.0bp to feature; MODIFIER	silent_mutation	Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0519414866	C -> T	LOC_Os05g33100.1	downstream_gene_variant ; 1275.0bp to feature; MODIFIER	silent_mutation	Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0519414866	C -> T	LOC_Os05g33120.1	downstream_gene_variant ; 3324.0bp to feature; MODIFIER	silent_mutation	Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0519414866	C -> T	LOC_Os05g33100-LOC_Os05g33110	intergenic_region ; MODIFIER	silent_mutation	Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519414866	NA	7.93E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519414866	NA	8.92E-12	mr1691	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519414866	NA	2.86E-06	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519414866	NA	1.81E-13	mr1693	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519414866	NA	7.80E-08	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519414866	NA	5.91E-10	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519414866	NA	8.82E-06	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251