\
| Variant ID: vg0519414866 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19414866 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGTCGGTGAGACTTATGGAGAGTAAAAGTAAACCCCAATGATTATCATGTTCGATTTTTATAATCTCAATGACAATAAGGAGGGGAGGCAGTAGGCGGG[C/T]
TGTAGAGAAGTATAGTGGCGAAGCCACTAACGATTTGGCGAGACTTATAGAAAGTAAAAAAAGAATACAAACAATAATTATGTTCAATTTTTAAAATCCC
GGGATTTTAAAAATTGAACATAATTATTGTTTGTATTCTTTTTTTACTTTCTATAAGTCTCGCCAAATCGTTAGTGGCTTCGCCACTATACTTCTCTACA[G/A]
CCCGCCTACTGCCTCCCCTCCTTATTGTCATTGAGATTATAAAAATCGAACATGATAATCATTGGGGTTTACTTTTACTCTCCATAAGTCTCACCGACCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 9.20% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 70.70% | 28.60% | 0.73% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 66.20% | 32.50% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 84.90% | 15.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 44.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519414866 | C -> T | LOC_Os05g33110.1 | upstream_gene_variant ; 523.0bp to feature; MODIFIER | silent_mutation | Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg0519414866 | C -> T | LOC_Os05g33110.2 | upstream_gene_variant ; 523.0bp to feature; MODIFIER | silent_mutation | Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg0519414866 | C -> T | LOC_Os05g33110.3 | upstream_gene_variant ; 523.0bp to feature; MODIFIER | silent_mutation | Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg0519414866 | C -> T | LOC_Os05g33100.1 | downstream_gene_variant ; 1275.0bp to feature; MODIFIER | silent_mutation | Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg0519414866 | C -> T | LOC_Os05g33120.1 | downstream_gene_variant ; 3324.0bp to feature; MODIFIER | silent_mutation | Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg0519414866 | C -> T | LOC_Os05g33100-LOC_Os05g33110 | intergenic_region ; MODIFIER | silent_mutation | Average:37.402; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519414866 | NA | 7.93E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519414866 | NA | 8.92E-12 | mr1691 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519414866 | NA | 2.86E-06 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519414866 | NA | 1.81E-13 | mr1693 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519414866 | NA | 7.80E-08 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519414866 | NA | 5.91E-10 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519414866 | NA | 8.82E-06 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |