\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519334588:

Variant ID: vg0519334588 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19334588
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCGTGGAATGGCATTGTGGCGAAACTCACTCTTGGCAGTGGCAGAATAGCCAATTTCTCGGCAGAAAGAGGCGGTGGCCGGTGGGATTTCCCAGCTTTA[G/A]
GCGACGGTGGCATCGTCCATCGTTGATATGCAAAATTAAGAGCGCTGAAATCGATCCTACTGAGACTTGGTTTCAGGTTATTTGAGACTATAAAATAAGC

Reverse complement sequence

GCTTATTTTATAGTCTCAAATAACCTGAAACCAAGTCTCAGTAGGATCGATTTCAGCGCTCTTAATTTTGCATATCAACGATGGACGATGCCACCGTCGC[C/T]
TAAAGCTGGGAAATCCCACCGGCCACCGCCTCTTTCTGCCGAGAAATTGGCTATTCTGCCACTGCCAAGAGTGAGTTTCGCCACAATGCCATTCCACGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.60% 2.10% 0.32% 0.00% NA
All Indica  2759 99.80% 0.20% 0.04% 0.00% NA
All Japonica  1512 93.50% 5.80% 0.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 99.60% 0.00% 0.39% 0.00% NA
Tropical Japonica  504 82.30% 15.90% 1.79% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519334588 G -> A LOC_Os05g32970.1 upstream_gene_variant ; 3104.0bp to feature; MODIFIER silent_mutation Average:71.483; most accessible tissue: Callus, score: 82.532 N N N N
vg0519334588 G -> A LOC_Os05g32980.1 downstream_gene_variant ; 164.0bp to feature; MODIFIER silent_mutation Average:71.483; most accessible tissue: Callus, score: 82.532 N N N N
vg0519334588 G -> A LOC_Os05g32990.1 downstream_gene_variant ; 2068.0bp to feature; MODIFIER silent_mutation Average:71.483; most accessible tissue: Callus, score: 82.532 N N N N
vg0519334588 G -> A LOC_Os05g32980-LOC_Os05g32990 intergenic_region ; MODIFIER silent_mutation Average:71.483; most accessible tissue: Callus, score: 82.532 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519334588 1.42E-06 1.42E-06 mr1286_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588 5.99E-07 5.99E-07 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588 9.62E-06 9.62E-06 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588 NA 3.09E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588 NA 8.39E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588 NA 1.62E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588 9.82E-07 1.03E-06 mr1665_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588 NA 3.89E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588 NA 7.89E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588 3.86E-06 3.86E-06 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251