Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0519334588:

Variant ID: vg0519334588 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19334588
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCGTGGAATGGCATTGTGGCGAAACTCACTCTTGGCAGTGGCAGAATAGCCAATTTCTCGGCAGAAAGAGGCGGTGGCCGGTGGGATTTCCCAGCTTTA[G/A]
GCGACGGTGGCATCGTCCATCGTTGATATGCAAAATTAAGAGCGCTGAAATCGATCCTACTGAGACTTGGTTTCAGGTTATTTGAGACTATAAAATAAGC

Reverse complement sequence

GCTTATTTTATAGTCTCAAATAACCTGAAACCAAGTCTCAGTAGGATCGATTTCAGCGCTCTTAATTTTGCATATCAACGATGGACGATGCCACCGTCGC[C/T]
TAAAGCTGGGAAATCCCACCGGCCACCGCCTCTTTCTGCCGAGAAATTGGCTATTCTGCCACTGCCAAGAGTGAGTTTCGCCACAATGCCATTCCACGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.60%	2.10%	0.32%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.04%	0.00%	NA
All Japonica	1512	93.50%	5.80%	0.79%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	99.60%	0.00%	0.39%	0.00%	NA
Tropical Japonica	504	82.30%	15.90%	1.79%	0.00%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519334588	G -> A	LOC_Os05g32970.1	upstream_gene_variant ; 3104.0bp to feature; MODIFIER	silent_mutation	Average:71.483; most accessible tissue: Callus, score: 82.532	N	N	N	N
vg0519334588	G -> A	LOC_Os05g32980.1	downstream_gene_variant ; 164.0bp to feature; MODIFIER	silent_mutation	Average:71.483; most accessible tissue: Callus, score: 82.532	N	N	N	N
vg0519334588	G -> A	LOC_Os05g32990.1	downstream_gene_variant ; 2068.0bp to feature; MODIFIER	silent_mutation	Average:71.483; most accessible tissue: Callus, score: 82.532	N	N	N	N
vg0519334588	G -> A	LOC_Os05g32980-LOC_Os05g32990	intergenic_region ; MODIFIER	silent_mutation	Average:71.483; most accessible tissue: Callus, score: 82.532	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519334588	1.42E-06	1.42E-06	mr1286_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588	5.99E-07	5.99E-07	mr1312_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588	9.62E-06	9.62E-06	mr1373_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588	NA	3.09E-06	mr1397_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588	NA	8.39E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588	NA	1.62E-06	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588	9.82E-07	1.03E-06	mr1665_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588	NA	3.89E-06	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588	NA	7.89E-06	mr1812_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519334588	3.86E-06	3.86E-06	mr1847_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251