\
| Variant ID: vg0519334588 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19334588 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCGTGGAATGGCATTGTGGCGAAACTCACTCTTGGCAGTGGCAGAATAGCCAATTTCTCGGCAGAAAGAGGCGGTGGCCGGTGGGATTTCCCAGCTTTA[G/A]
GCGACGGTGGCATCGTCCATCGTTGATATGCAAAATTAAGAGCGCTGAAATCGATCCTACTGAGACTTGGTTTCAGGTTATTTGAGACTATAAAATAAGC
GCTTATTTTATAGTCTCAAATAACCTGAAACCAAGTCTCAGTAGGATCGATTTCAGCGCTCTTAATTTTGCATATCAACGATGGACGATGCCACCGTCGC[C/T]
TAAAGCTGGGAAATCCCACCGGCCACCGCCTCTTTCTGCCGAGAAATTGGCTATTCTGCCACTGCCAAGAGTGAGTTTCGCCACAATGCCATTCCACGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.60% | 2.10% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 93.50% | 5.80% | 0.79% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 82.30% | 15.90% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519334588 | G -> A | LOC_Os05g32970.1 | upstream_gene_variant ; 3104.0bp to feature; MODIFIER | silent_mutation | Average:71.483; most accessible tissue: Callus, score: 82.532 | N | N | N | N |
| vg0519334588 | G -> A | LOC_Os05g32980.1 | downstream_gene_variant ; 164.0bp to feature; MODIFIER | silent_mutation | Average:71.483; most accessible tissue: Callus, score: 82.532 | N | N | N | N |
| vg0519334588 | G -> A | LOC_Os05g32990.1 | downstream_gene_variant ; 2068.0bp to feature; MODIFIER | silent_mutation | Average:71.483; most accessible tissue: Callus, score: 82.532 | N | N | N | N |
| vg0519334588 | G -> A | LOC_Os05g32980-LOC_Os05g32990 | intergenic_region ; MODIFIER | silent_mutation | Average:71.483; most accessible tissue: Callus, score: 82.532 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519334588 | 1.42E-06 | 1.42E-06 | mr1286_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519334588 | 5.99E-07 | 5.99E-07 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519334588 | 9.62E-06 | 9.62E-06 | mr1373_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519334588 | NA | 3.09E-06 | mr1397_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519334588 | NA | 8.39E-06 | mr1556_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519334588 | NA | 1.62E-06 | mr1646_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519334588 | 9.82E-07 | 1.03E-06 | mr1665_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519334588 | NA | 3.89E-06 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519334588 | NA | 7.89E-06 | mr1812_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519334588 | 3.86E-06 | 3.86E-06 | mr1847_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |