Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519295480:

Variant ID: vg0519295480 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19295480
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTTTGCTCCAGCATATGGCAGAAGTTGGCCCATACTTTGAGGAGCACTTAGCGAAAATCTGAGAAGAGAACTTGGGGAGATCTGATGCATGGATTAACA[G/T]
AGAACATAATTCTCGGTTCAACGAATGGTTCAAGAATCGTGTGACAATGTCCACGGATGTCCCAAATGAGACAGTACAGTTGTTGGGGATGGGACTGTCT

Reverse complement sequence

AGACAGTCCCATCCCCAACAACTGTACTGTCTCATTTGGGACATCCGTGGACATTGTCACACGATTCTTGAACCATTCGTTGAACCGAGAATTATGTTCT[C/A]
TGTTAATCCATGCATCAGATCTCCCCAAGTTCTCTTCTCAGATTTTCGCTAAGTGCTCCTCAAAGTATGGGCCAACTTCTGCCATATGCTGGAGCAAAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.90%	3.80%	3.68%	21.63%	NA
All Indica	2759	62.20%	1.20%	5.91%	30.74%	NA
All Japonica	1512	78.90%	9.40%	0.66%	11.04%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	32.60%	3.70%	8.07%	55.63%	NA
Indica II	465	85.60%	0.00%	2.15%	12.26%	NA
Indica III	913	61.40%	0.40%	8.54%	29.57%	NA
Indica Intermediate	786	71.60%	0.80%	3.44%	24.17%	NA
Temperate Japonica	767	92.00%	6.60%	0.13%	1.17%	NA
Tropical Japonica	504	69.20%	3.40%	0.99%	26.39%	NA
Japonica Intermediate	241	57.30%	30.70%	1.66%	10.37%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	2.20%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519295480	G -> T	LOC_Os05g32920.1	upstream_gene_variant ; 4812.0bp to feature; MODIFIER	silent_mutation	Average:25.347; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0519295480	G -> T	LOC_Os05g32930.1	upstream_gene_variant ; 1021.0bp to feature; MODIFIER	silent_mutation	Average:25.347; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0519295480	G -> T	LOC_Os05g32950.1	downstream_gene_variant ; 1184.0bp to feature; MODIFIER	silent_mutation	Average:25.347; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0519295480	G -> T	LOC_Os05g32940.1	intron_variant ; MODIFIER	silent_mutation	Average:25.347; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0519295480	G -> DEL	N	N	silent_mutation	Average:25.347; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519295480	NA	8.98E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	2.61E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	2.07E-08	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	4.91E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	4.87E-06	3.15E-06	mr1150	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	1.52E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	1.63E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	1.03E-07	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	4.53E-08	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	3.52E-06	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	5.33E-06	3.16E-07	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	1.27E-07	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	7.12E-07	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	8.36E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	7.17E-07	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	9.08E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519295480	NA	9.21E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251