Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519252225:

Variant ID: vg0519252225 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19252225
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

TATAGGCAGTAGCGGCGCCGCCGCAAAAGGGGGAGGGGAAGGATTCTCTGGAATGGTCTGTTGGTTTATTTGCCTGACTCTTTTTTTTCCTTTTTTTTTC[G/A]
GGAGTGGGCATAGCCGCATAAGGGAAAGGAGGGCACGTGGCACGATTTTAGGAGAGGTAACCTAGATCGTGGAAACGCCATGTGGCCCAATGACAAGCCA

Reverse complement sequence

TGGCTTGTCATTGGGCCACATGGCGTTTCCACGATCTAGGTTACCTCTCCTAAAATCGTGCCACGTGCCCTCCTTTCCCTTATGCGGCTATGCCCACTCC[C/T]
GAAAAAAAAAGGAAAAAAAAGAGTCAGGCAAATAAACCAACAGACCATTCCAGAGAATCCTTCCCCTCCCCCTTTTGCGGCGGCGCCGCTACTGCCTATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.90%	2.50%	0.61%	0.00%	NA
All Indica	2759	95.20%	3.80%	0.94%	0.00%	NA
All Japonica	1512	99.60%	0.30%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.00%	0.67%	0.00%	NA
Indica II	465	78.70%	17.80%	3.44%	0.00%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	96.60%	2.80%	0.64%	0.00%	NA
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519252225	G -> A	LOC_Os05g32870.1	upstream_gene_variant ; 1389.0bp to feature; MODIFIER	silent_mutation	Average:51.136; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0519252225	G -> A	LOC_Os05g32880.1	downstream_gene_variant ; 3266.0bp to feature; MODIFIER	silent_mutation	Average:51.136; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0519252225	G -> A	LOC_Os05g32860-LOC_Os05g32870	intergenic_region ; MODIFIER	silent_mutation	Average:51.136; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519252225	NA	9.95E-06	mr1002	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519252225	NA	1.92E-08	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519252225	NA	7.99E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519252225	NA	8.15E-07	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519252225	NA	1.55E-08	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519252225	4.54E-06	2.80E-06	mr1514_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519252225	NA	3.15E-08	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251