\
| Variant ID: vg0519252225 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19252225 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )
TATAGGCAGTAGCGGCGCCGCCGCAAAAGGGGGAGGGGAAGGATTCTCTGGAATGGTCTGTTGGTTTATTTGCCTGACTCTTTTTTTTCCTTTTTTTTTC[G/A]
GGAGTGGGCATAGCCGCATAAGGGAAAGGAGGGCACGTGGCACGATTTTAGGAGAGGTAACCTAGATCGTGGAAACGCCATGTGGCCCAATGACAAGCCA
TGGCTTGTCATTGGGCCACATGGCGTTTCCACGATCTAGGTTACCTCTCCTAAAATCGTGCCACGTGCCCTCCTTTCCCTTATGCGGCTATGCCCACTCC[C/T]
GAAAAAAAAAGGAAAAAAAAGAGTCAGGCAAATAAACCAACAGACCATTCCAGAGAATCCTTCCCCTCCCCCTTTTGCGGCGGCGCCGCTACTGCCTATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.90% | 2.50% | 0.61% | 0.00% | NA |
| All Indica | 2759 | 95.20% | 3.80% | 0.94% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 78.70% | 17.80% | 3.44% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 2.80% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519252225 | G -> A | LOC_Os05g32870.1 | upstream_gene_variant ; 1389.0bp to feature; MODIFIER | silent_mutation | Average:51.136; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| vg0519252225 | G -> A | LOC_Os05g32880.1 | downstream_gene_variant ; 3266.0bp to feature; MODIFIER | silent_mutation | Average:51.136; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| vg0519252225 | G -> A | LOC_Os05g32860-LOC_Os05g32870 | intergenic_region ; MODIFIER | silent_mutation | Average:51.136; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519252225 | NA | 9.95E-06 | mr1002 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519252225 | NA | 1.92E-08 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519252225 | NA | 7.99E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519252225 | NA | 8.15E-07 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519252225 | NA | 1.55E-08 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519252225 | 4.54E-06 | 2.80E-06 | mr1514_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519252225 | NA | 3.15E-08 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |