Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519243501:

Variant ID: vg0519243501 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19243501
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, G: 0.45, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TCATAGTCGTGCAAATGCGTGATTTCATACACTAGTTTTATTGAATAGGGAATAATGAATGAGTACGACTGTCTTTTGGAAAGGGAGTATCTAAAAATCT[G/A]
TCGAAGTTTTTTGGTCAAAAACTTTCAAATATAACAATAGTATAATTAAAGTGTAATTACATTGTAACTGCACTGAAACTTACCGTAACTGCACTCTAAA

Reverse complement sequence

TTTAGAGTGCAGTTACGGTAAGTTTCAGTGCAGTTACAATGTAATTACACTTTAATTATACTATTGTTATATTTGAAAGTTTTTGACCAAAAAACTTCGA[C/T]
AGATTTTTAGATACTCCCTTTCCAAAAGACAGTCGTACTCATTCATTATTCCCTATTCAATAAAACTAGTGTATGAAATCACGCATTTGCACGACTATGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.60%	48.80%	0.61%	0.06%	NA
All Indica	2759	63.40%	35.70%	0.94%	0.04%	NA
All Japonica	1512	25.00%	74.90%	0.07%	0.07%	NA
Aus	269	84.00%	16.00%	0.00%	0.00%	NA
Indica I	595	80.00%	19.20%	0.84%	0.00%	NA
Indica II	465	53.10%	45.80%	1.08%	0.00%	NA
Indica III	913	62.50%	36.60%	0.88%	0.00%	NA
Indica Intermediate	786	57.80%	41.10%	1.02%	0.13%	NA
Temperate Japonica	767	13.20%	86.80%	0.00%	0.00%	NA
Tropical Japonica	504	33.50%	66.10%	0.20%	0.20%	NA
Japonica Intermediate	241	44.80%	55.20%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	33.30%	63.30%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519243501	G -> DEL	N	N	silent_mutation	Average:35.188; most accessible tissue: Callus, score: 83.134	N	N	N	N
vg0519243501	G -> A	LOC_Os05g32850.1	downstream_gene_variant ; 3071.0bp to feature; MODIFIER	silent_mutation	Average:35.188; most accessible tissue: Callus, score: 83.134	N	N	N	N
vg0519243501	G -> A	LOC_Os05g32860.1	downstream_gene_variant ; 2068.0bp to feature; MODIFIER	silent_mutation	Average:35.188; most accessible tissue: Callus, score: 83.134	N	N	N	N
vg0519243501	G -> A	LOC_Os05g32850.2	downstream_gene_variant ; 4861.0bp to feature; MODIFIER	silent_mutation	Average:35.188; most accessible tissue: Callus, score: 83.134	N	N	N	N
vg0519243501	G -> A	LOC_Os05g32860-LOC_Os05g32870	intergenic_region ; MODIFIER	silent_mutation	Average:35.188; most accessible tissue: Callus, score: 83.134	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519243501	NA	1.97E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	1.96E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	6.02E-06	2.07E-06	mr1685	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	7.46E-07	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	3.33E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	5.61E-07	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	5.87E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	2.80E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	8.17E-07	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	5.27E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	6.08E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	9.98E-06	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	5.59E-06	mr1333_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	2.39E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	2.19E-08	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	2.58E-08	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519243501	NA	7.33E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251