\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519242289:

Variant ID: vg0519242289 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19242289
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.54, T: 0.46, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCTAATGCGTGATCACCCGCACGCCCCCCTCCTCCTATACGCTCTCTCCCCATTCCTCCTCCCATCCTTCTATTTCTACTACATTACACCATAAAATT[T/A]
AAAAAAAATTGAAAAAAAATTATGTATAGAAATACTATATATATAAAAAATATTTGAATTCAAATTCAAATTTGAAACGGGTATGTAAACTTTTGACTTA

Reverse complement sequence

TAAGTCAAAAGTTTACATACCCGTTTCAAATTTGAATTTGAATTCAAATATTTTTTATATATATAGTATTTCTATACATAATTTTTTTTCAATTTTTTTT[A/T]
AATTTTATGGTGTAATGTAGTAGAAATAGAAGGATGGGAGGAGGAATGGGGAGAGAGCGTATAGGAGGAGGGGGGCGTGCGGGTGATCACGCATTAGCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 43.70% 4.82% 0.17% NA
All Indica  2759 64.70% 27.60% 7.43% 0.29% NA
All Japonica  1512 25.10% 74.40% 0.53% 0.00% NA
Aus  269 83.30% 14.50% 2.23% 0.00% NA
Indica I  595 80.20% 13.60% 6.05% 0.17% NA
Indica II  465 53.50% 36.30% 9.68% 0.43% NA
Indica III  913 64.30% 29.00% 6.46% 0.22% NA
Indica Intermediate  786 59.90% 31.40% 8.27% 0.38% NA
Temperate Japonica  767 13.20% 86.20% 0.65% 0.00% NA
Tropical Japonica  504 33.70% 65.70% 0.60% 0.00% NA
Japonica Intermediate  241 44.80% 55.20% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 35.60% 54.40% 10.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519242289 T -> DEL N N silent_mutation Average:87.104; most accessible tissue: Zhenshan97 flower, score: 96.038 N N N N
vg0519242289 T -> A LOC_Os05g32850.1 downstream_gene_variant ; 1859.0bp to feature; MODIFIER silent_mutation Average:87.104; most accessible tissue: Zhenshan97 flower, score: 96.038 N N N N
vg0519242289 T -> A LOC_Os05g32860.1 downstream_gene_variant ; 856.0bp to feature; MODIFIER silent_mutation Average:87.104; most accessible tissue: Zhenshan97 flower, score: 96.038 N N N N
vg0519242289 T -> A LOC_Os05g32850.2 downstream_gene_variant ; 3649.0bp to feature; MODIFIER silent_mutation Average:87.104; most accessible tissue: Zhenshan97 flower, score: 96.038 N N N N
vg0519242289 T -> A LOC_Os05g32860-LOC_Os05g32870 intergenic_region ; MODIFIER silent_mutation Average:87.104; most accessible tissue: Zhenshan97 flower, score: 96.038 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0519242289 T A 0.0 0.0 0.0 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519242289 NA 5.27E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 6.88E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 5.87E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 8.10E-10 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 5.59E-08 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 1.80E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 9.05E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 7.97E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 9.21E-06 mr1199_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 5.92E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 3.80E-09 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 5.25E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 4.98E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 6.12E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 2.61E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 2.30E-08 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 5.84E-07 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 1.05E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 6.78E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 5.30E-10 mr1763_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 2.81E-06 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 2.78E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 8.26E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 2.15E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 2.26E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 3.44E-06 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 9.55E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 1.51E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519242289 NA 7.18E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251