\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519226149:

Variant ID: vg0519226149 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19226149
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGTGCGTGTGCCTCTTGCACTAGACAAGGGTTGGGTTTTGGAGTTCTTTACCTATGTGCCATTAAAAAAAGATGTAACTGTCTATGTGCCACTAAAAT[G/A]
TTTGAACCTTCATGTATATCACTGTTCTGTTTGGATTTAACCATTTGACAGCTCTGACATGTGGGCCCGGACAGAAAAAATGAGTATCTTCTTTCGAGTG

Reverse complement sequence

CACTCGAAAGAAGATACTCATTTTTTCTGTCCGGGCCCACATGTCAGAGCTGTCAAATGGTTAAATCCAAACAGAACAGTGATATACATGAAGGTTCAAA[C/T]
ATTTTAGTGGCACATAGACAGTTACATCTTTTTTTAATGGCACATAGGTAAAGAACTCCAAAACCCAACCCTTGTCTAGTGCAAGAGGCACACGCACGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.30% 30.60% 0.44% 0.61% NA
All Indica  2759 97.00% 1.70% 0.36% 0.94% NA
All Japonica  1512 15.00% 84.50% 0.40% 0.07% NA
Aus  269 97.40% 2.20% 0.37% 0.00% NA
Indica I  595 95.60% 2.00% 0.84% 1.51% NA
Indica II  465 98.50% 1.30% 0.00% 0.22% NA
Indica III  913 98.60% 0.90% 0.33% 0.22% NA
Indica Intermediate  786 95.30% 2.70% 0.25% 1.78% NA
Temperate Japonica  767 5.20% 94.70% 0.13% 0.00% NA
Tropical Japonica  504 30.40% 68.80% 0.60% 0.20% NA
Japonica Intermediate  241 14.10% 85.10% 0.83% 0.00% NA
VI/Aromatic  96 7.30% 91.70% 1.04% 0.00% NA
Intermediate  90 63.30% 31.10% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519226149 G -> DEL N N silent_mutation Average:98.117; most accessible tissue: Zhenshan97 flag leaf, score: 99.282 N N N N
vg0519226149 G -> A LOC_Os05g32820.1 upstream_gene_variant ; 1709.0bp to feature; MODIFIER silent_mutation Average:98.117; most accessible tissue: Zhenshan97 flag leaf, score: 99.282 N N N N
vg0519226149 G -> A LOC_Os05g32830.1 upstream_gene_variant ; 874.0bp to feature; MODIFIER silent_mutation Average:98.117; most accessible tissue: Zhenshan97 flag leaf, score: 99.282 N N N N
vg0519226149 G -> A LOC_Os05g32840.1 downstream_gene_variant ; 4834.0bp to feature; MODIFIER silent_mutation Average:98.117; most accessible tissue: Zhenshan97 flag leaf, score: 99.282 N N N N
vg0519226149 G -> A LOC_Os05g32820-LOC_Os05g32830 intergenic_region ; MODIFIER silent_mutation Average:98.117; most accessible tissue: Zhenshan97 flag leaf, score: 99.282 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0519226149 G A 0.22 0.13 0.1 0.02 0.05 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519226149 NA 4.91E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 2.48E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 4.72E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 1.26E-08 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 7.46E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 9.81E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 2.68E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 8.80E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 3.76E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 9.48E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 7.20E-07 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 5.65E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 6.09E-08 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 1.42E-08 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 9.10E-07 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 7.12E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 5.62E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 3.28E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 5.11E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 1.01E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 4.45E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 3.62E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 4.73E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 5.63E-06 mr1901_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 2.38E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519226149 NA 3.39E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251