Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519198286:

Variant ID: vg0519198286 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19198286
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGCTCATACGGAGTACATGAAATGTGTTTCGAATAAGGGAAGTGATGGCAACAGAATGCCCGATCTTCCGTCAGGTGAAGATAACTATCGATTTGGTG[G/A,C]
AAACTTGACACATACGATCCGGCTTCCGATCTACACGATCCGAACCCTGCAATCCTAGCACAACATCTCCTCTGGTTATCAACCGTGTCGAAACCCGATT

Reverse complement sequence

AATCGGGTTTCGACACGGTTGATAACCAGAGGAGATGTTGTGCTAGGATTGCAGGGTTCGGATCGTGTAGATCGGAAGCCGGATCGTATGTGTCAAGTTT[C/T,G]
CACCAAATCGATAGTTATCTTCACCTGACGGAAGATCGGGCATTCTGTTGCCATCACTTCCCTTATTCGAAACACATTTCATGTACTCCGTATGAGCTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	31.60%	0.40%	0.00%	NA
All Indica	2759	49.40%	50.10%	0.54%	0.00%	NA
All Japonica	1512	97.30%	2.50%	0.20%	0.00%	NA
Aus	269	85.50%	14.50%	0.00%	0.00%	NA
Indica I	595	76.80%	22.70%	0.50%	0.00%	NA
Indica II	465	42.20%	57.80%	0.00%	0.00%	NA
Indica III	913	41.00%	58.60%	0.44%	0.00%	NA
Indica Intermediate	786	42.70%	56.20%	1.02%	0.00%	NA
Temperate Japonica	767	96.10%	3.80%	0.13%	0.00%	NA
Tropical Japonica	504	98.20%	1.40%	0.40%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	37.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519198286	G -> C	LOC_Os05g32770.1	upstream_gene_variant ; 1214.0bp to feature; MODIFIER	N	Average:42.652; most accessible tissue: Callus, score: 62.187	N	N	N	N
vg0519198286	G -> C	LOC_Os05g32770-LOC_Os05g32780	intergenic_region ; MODIFIER	N	Average:42.652; most accessible tissue: Callus, score: 62.187	N	N	N	N
vg0519198286	G -> A	LOC_Os05g32770.1	upstream_gene_variant ; 1214.0bp to feature; MODIFIER	silent_mutation	Average:42.652; most accessible tissue: Callus, score: 62.187	N	N	N	N
vg0519198286	G -> A	LOC_Os05g32770-LOC_Os05g32780	intergenic_region ; MODIFIER	silent_mutation	Average:42.652; most accessible tissue: Callus, score: 62.187	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519198286	7.67E-06	NA	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519198286	6.33E-06	NA	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519198286	NA	2.76E-06	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519198286	NA	7.50E-06	mr1326_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519198286	NA	5.33E-06	mr1333_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519198286	NA	3.85E-06	mr1623_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251