\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519198286:

Variant ID: vg0519198286 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19198286
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGCTCATACGGAGTACATGAAATGTGTTTCGAATAAGGGAAGTGATGGCAACAGAATGCCCGATCTTCCGTCAGGTGAAGATAACTATCGATTTGGTG[G/A,C]
AAACTTGACACATACGATCCGGCTTCCGATCTACACGATCCGAACCCTGCAATCCTAGCACAACATCTCCTCTGGTTATCAACCGTGTCGAAACCCGATT

Reverse complement sequence

AATCGGGTTTCGACACGGTTGATAACCAGAGGAGATGTTGTGCTAGGATTGCAGGGTTCGGATCGTGTAGATCGGAAGCCGGATCGTATGTGTCAAGTTT[C/T,G]
CACCAAATCGATAGTTATCTTCACCTGACGGAAGATCGGGCATTCTGTTGCCATCACTTCCCTTATTCGAAACACATTTCATGTACTCCGTATGAGCTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.60% 0.40% 0.00% NA
All Indica  2759 49.40% 50.10% 0.54% 0.00% NA
All Japonica  1512 97.30% 2.50% 0.20% 0.00% NA
Aus  269 85.50% 14.50% 0.00% 0.00% NA
Indica I  595 76.80% 22.70% 0.50% 0.00% NA
Indica II  465 42.20% 57.80% 0.00% 0.00% NA
Indica III  913 41.00% 58.60% 0.44% 0.00% NA
Indica Intermediate  786 42.70% 56.20% 1.02% 0.00% NA
Temperate Japonica  767 96.10% 3.80% 0.13% 0.00% NA
Tropical Japonica  504 98.20% 1.40% 0.40% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519198286 G -> C LOC_Os05g32770.1 upstream_gene_variant ; 1214.0bp to feature; MODIFIER N Average:42.652; most accessible tissue: Callus, score: 62.187 N N N N
vg0519198286 G -> C LOC_Os05g32770-LOC_Os05g32780 intergenic_region ; MODIFIER N Average:42.652; most accessible tissue: Callus, score: 62.187 N N N N
vg0519198286 G -> A LOC_Os05g32770.1 upstream_gene_variant ; 1214.0bp to feature; MODIFIER silent_mutation Average:42.652; most accessible tissue: Callus, score: 62.187 N N N N
vg0519198286 G -> A LOC_Os05g32770-LOC_Os05g32780 intergenic_region ; MODIFIER silent_mutation Average:42.652; most accessible tissue: Callus, score: 62.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519198286 7.67E-06 NA mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519198286 6.33E-06 NA mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519198286 NA 2.76E-06 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519198286 NA 7.50E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519198286 NA 5.33E-06 mr1333_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519198286 NA 3.85E-06 mr1623_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251