\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519193960:

Variant ID: vg0519193960 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19193960
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CTTATCCACTCTGTCCCTCACACACTCTCTCTTATCCACATAAACAAAAGATCTCTCTCTCCCTTATCCATACTCACAGAAGCAAGAGGGGAGGCTCTTG[C/G]
GGGGCGGCGGAGGACCCGACGGCCCCCGAGAGAGGCGGCGGCGGCGGCGCGCGGCGGTGGTTCAGCGGCGTTGGGCGACGGCTCAGCAGCGCGTGGCAGC

Reverse complement sequence

GCTGCCACGCGCTGCTGAGCCGTCGCCCAACGCCGCTGAACCACCGCCGCGCGCCGCCGCCGCCGCCTCTCTCGGGGGCCGTCGGGTCCTCCGCCGCCCC[G/C]
CAAGAGCCTCCCCTCTTGCTTCTGTGAGTATGGATAAGGGAGAGAGAGATCTTTTGTTTATGTGGATAAGAGAGAGTGTGTGAGGGACAGAGTGGATAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 32.20% 1.06% 0.25% NA
All Indica  2759 48.00% 51.20% 0.76% 0.00% NA
All Japonica  1512 95.40% 2.80% 1.06% 0.66% NA
Aus  269 86.60% 11.50% 1.86% 0.00% NA
Indica I  595 76.00% 23.20% 0.84% 0.00% NA
Indica II  465 42.20% 57.60% 0.22% 0.00% NA
Indica III  913 41.50% 57.50% 0.99% 0.00% NA
Indica Intermediate  786 37.90% 61.30% 0.76% 0.00% NA
Temperate Japonica  767 95.00% 3.90% 0.91% 0.13% NA
Tropical Japonica  504 97.00% 1.60% 1.19% 0.20% NA
Japonica Intermediate  241 93.40% 2.10% 1.24% 3.32% NA
VI/Aromatic  96 95.80% 1.00% 1.04% 2.08% NA
Intermediate  90 55.60% 36.70% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519193960 C -> DEL N N silent_mutation Average:77.846; most accessible tissue: Minghui63 flag leaf, score: 89.905 N N N N
vg0519193960 C -> G LOC_Os05g32770.1 downstream_gene_variant ; 303.0bp to feature; MODIFIER silent_mutation Average:77.846; most accessible tissue: Minghui63 flag leaf, score: 89.905 N N N N
vg0519193960 C -> G LOC_Os05g32760-LOC_Os05g32770 intergenic_region ; MODIFIER silent_mutation Average:77.846; most accessible tissue: Minghui63 flag leaf, score: 89.905 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0519193960 C G -0.14 -0.08 -0.12 -0.15 -0.16 -0.16

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519193960 NA 7.13E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519193960 NA 8.29E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519193960 NA 4.00E-06 mr1131_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519193960 NA 1.58E-06 mr1199_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519193960 4.44E-06 NA mr1322_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519193960 6.15E-06 NA mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519193960 2.27E-06 8.25E-08 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519193960 6.76E-06 NA mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519193960 4.62E-06 4.49E-07 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519193960 NA 6.57E-07 mr1333_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519193960 NA 1.66E-06 mr1623_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251