Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0519159149:

Variant ID: vg0519159149 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19159149
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGTTCATGCACCTCCTATGTGCCCTAGAAGAACCTGTCCTTCTGCCGTTGCTCTGGCCCTCCCAGTGCCACCATGGCGCCCAACCACCACCACCCCCA[C/T]
CGCAACAATAACAGCAACAACAGATCAAATCAAGACCCTCACAGTCGCTATCTCTCACCTCATAAATCCTGCGGACACAATCTTGCACACGCAAAAACCG

Reverse complement sequence

CGGTTTTTGCGTGTGCAAGATTGTGTCCGCAGGATTTATGAGGTGAGAGATAGCGACTGTGAGGGTCTTGATTTGATCTGTTGTTGCTGTTATTGTTGCG[G/A]
TGGGGGTGGTGGTGGTTGGGCGCCATGGTGGCACTGGGAGGGCCAGAGCAACGGCAGAAGGACAGGTTCTTCTAGGGCACATAGGAGGTGCATGAACAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 32.20% 0.11% 0.63% NA
All Indica  2759 47.80% 51.30% 0.04% 0.94% NA
All Japonica  1512 97.30% 2.60% 0.00% 0.07% NA
Aus  269 85.90% 12.60% 1.49% 0.00% NA
Indica I  595 76.50% 22.90% 0.00% 0.67% NA
Indica II  465 41.70% 56.80% 0.00% 1.51% NA
Indica III  913 40.40% 58.80% 0.00% 0.77% NA
Indica Intermediate  786 38.20% 60.70% 0.13% 1.02% NA
Temperate Japonica  767 96.10% 3.90% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.60% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 61.10% 35.60% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519159149 C -> T LOC_Os05g32710.1 upstream_gene_variant ; 1549.0bp to feature; MODIFIER silent_mutation Average:87.04; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0519159149 C -> T LOC_Os05g32720.1 upstream_gene_variant ; 991.0bp to feature; MODIFIER silent_mutation Average:87.04; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0519159149 C -> T LOC_Os05g32710-LOC_Os05g32720 intergenic_region ; MODIFIER silent_mutation Average:87.04; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0519159149 C -> DEL N N silent_mutation Average:87.04; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0519159149 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519159149 NA 1.48E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 NA 4.05E-09 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 NA 6.71E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 NA 2.53E-06 mr1131_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 NA 1.02E-06 mr1199_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 4.98E-06 NA mr1322_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 5.06E-06 6.76E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 4.93E-06 9.05E-08 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 3.24E-06 NA mr1326_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 3.08E-06 1.47E-07 mr1326_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 NA 1.19E-07 mr1333_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 NA 2.94E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 NA 5.29E-06 mr1623_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519159149 NA 5.95E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251