| Variant ID: vg0519136766 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19136766 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTCGCCCGGTAATCACCCTTAAGGGGTGAGATAGCACGACAACGCCCTCAGGAGGGGGAATTCATCGTTGTCGGTCCGGCCAAGGCTGGGCTGGGTTTTC[A/C]
CCCGCCGCTCACCACCTACGAATCTACGGCTGATGCACCGATGCTCCACCACCACTCAAACTCTGCCGACATGTGGGGCCCTGCACGAATGCCCCCGCCG
CGGCGGGGGCATTCGTGCAGGGCCCCACATGTCGGCAGAGTTTGAGTGGTGGTGGAGCATCGGTGCATCAGCCGTAGATTCGTAGGTGGTGAGCGGCGGG[T/G]
GAAAACCCAGCCCAGCCTTGGCCGGACCGACAACGATGAATTCCCCCTCCTGAGGGCGTTGTCGTGCTATCTCACCCCTTAAGGGTGATTACCGGGCGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 1.80% | 4.17% | 0.00% | NA |
| All Indica | 2759 | 92.10% | 2.20% | 5.65% | 0.00% | NA |
| All Japonica | 1512 | 96.60% | 1.10% | 2.31% | 0.00% | NA |
| Aus | 269 | 97.00% | 1.10% | 1.86% | 0.00% | NA |
| Indica I | 595 | 94.60% | 1.30% | 4.03% | 0.00% | NA |
| Indica II | 465 | 88.80% | 2.40% | 8.82% | 0.00% | NA |
| Indica III | 913 | 91.90% | 3.20% | 4.93% | 0.00% | NA |
| Indica Intermediate | 786 | 92.50% | 1.70% | 5.85% | 0.00% | NA |
| Temperate Japonica | 767 | 97.90% | 0.50% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 94.40% | 2.00% | 3.57% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 1.20% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519136766 | A -> C | LOC_Os05g32680.1 | downstream_gene_variant ; 824.0bp to feature; MODIFIER | silent_mutation | Average:65.378; most accessible tissue: Minghui63 flag leaf, score: 82.053 | N | N | N | N |
| vg0519136766 | A -> C | LOC_Os05g32690.1 | downstream_gene_variant ; 485.0bp to feature; MODIFIER | silent_mutation | Average:65.378; most accessible tissue: Minghui63 flag leaf, score: 82.053 | N | N | N | N |
| vg0519136766 | A -> C | LOC_Os05g32680-LOC_Os05g32690 | intergenic_region ; MODIFIER | silent_mutation | Average:65.378; most accessible tissue: Minghui63 flag leaf, score: 82.053 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519136766 | 4.13E-06 | NA | mr1698 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519136766 | 6.23E-07 | 6.23E-07 | mr1717 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519136766 | NA | 2.51E-06 | mr1131_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519136766 | NA | 8.74E-07 | mr1199_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519136766 | NA | 7.43E-06 | mr1326_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519136766 | NA | 3.99E-06 | mr1333_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |