\
| Variant ID: vg0519106763 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19106763 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 111. )
AGTTATTTATATATTTATATAATTTTACACGGTAGTTACAACACACTTACACATCAGTTACGTATGTAAACTCGACTTACACATCACTTACATATGTAAT[T/C]
AGTATGTAATTTTGGGATTTACATATGTAATTTTAGGACTTACATATGTAATTTTGGGAGTTACATTGTAAATATAATAAAATTACATATGTAATTTTGG
CCAAAATTACATATGTAATTTTATTATATTTACAATGTAACTCCCAAAATTACATATGTAAGTCCTAAAATTACATATGTAAATCCCAAAATTACATACT[A/G]
ATTACATATGTAAGTGATGTGTAAGTCGAGTTTACATACGTAACTGATGTGTAAGTGTGTTGTAACTACCGTGTAAAATTATATAAATATATAAATAACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 34.90% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 55.80% | 43.40% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 87.00% | 12.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 14.10% | 85.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 28.10% | 71.30% | 0.67% | 0.00% | NA |
| Indica II | 465 | 60.90% | 38.10% | 1.08% | 0.00% | NA |
| Indica III | 913 | 63.20% | 36.10% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 65.30% | 33.80% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.60% | 30.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519106763 | T -> C | LOC_Os05g32620.1 | downstream_gene_variant ; 1804.0bp to feature; MODIFIER | silent_mutation | Average:35.085; most accessible tissue: Callus, score: 66.538 | N | N | N | N |
| vg0519106763 | T -> C | LOC_Os05g32630.1 | downstream_gene_variant ; 1799.0bp to feature; MODIFIER | silent_mutation | Average:35.085; most accessible tissue: Callus, score: 66.538 | N | N | N | N |
| vg0519106763 | T -> C | LOC_Os05g32620-LOC_Os05g32630 | intergenic_region ; MODIFIER | silent_mutation | Average:35.085; most accessible tissue: Callus, score: 66.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519106763 | NA | 4.51E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 8.43E-06 | mr1199 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 7.46E-08 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 3.55E-07 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 2.38E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 9.20E-08 | mr1131_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 6.31E-09 | mr1199_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 3.89E-06 | mr1325_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 2.07E-06 | mr1333_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 1.61E-08 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 3.07E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 8.92E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 5.49E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 1.26E-14 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 4.54E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519106763 | NA | 1.17E-08 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |