\
| Variant ID: vg0518975375 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 18975375 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, T: 0.13, others allele: 0.00, population size: 250. )
GCCATACATTAGTATAGACAGCACTGCTTTAAATGGCAGATGGAATGGCCACTTAGCATCTGCTACAGCTGTAGATGGGCATAATTGGATGTATCCTCTT[T/G]
CTATTGGGTTTATAGATTTAGAGACTGAGGATAACTGGGAGTGGTTCATGAGTCAGCTTCATGCTGCCATAGGAGATGTTAACCCTCTAGCTGTATGCAC
GTGCATACAGCTAGAGGGTTAACATCTCCTATGGCAGCATGAAGCTGACTCATGAACCACTCCCAGTTATCCTCAGTCTCTAAATCTATAAACCCAATAG[A/C]
AAGAGGATACATCCAATTATGCCCATCTACAGCTGTAGCAGATGCTAAGTGGCCATTCCATCTGCCATTTAAAGCAGTGCTGTCTATACTAATGTATGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.90% | 30.20% | 0.55% | 15.34% | NA |
| All Indica | 2759 | 71.90% | 1.20% | 0.87% | 26.10% | NA |
| All Japonica | 1512 | 15.50% | 84.20% | 0.00% | 0.26% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 39.50% | 0.50% | 1.51% | 58.49% | NA |
| Indica II | 465 | 89.00% | 1.70% | 0.22% | 9.03% | NA |
| Indica III | 913 | 73.80% | 1.10% | 0.55% | 24.53% | NA |
| Indica Intermediate | 786 | 84.00% | 1.40% | 1.15% | 13.49% | NA |
| Temperate Japonica | 767 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 32.50% | 66.70% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 13.70% | 86.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 33.30% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0518975375 | T -> DEL | LOC_Os05g32480.1 | N | frameshift_variant | Average:36.042; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0518975375 | T -> G | LOC_Os05g32480.1 | missense_variant ; p.Ser495Ala; MODERATE | nonsynonymous_codon ; S495A | Average:36.042; most accessible tissue: Minghui63 young leaf, score: 68.745 | benign |
-0.495 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0518975375 | NA | 8.29E-10 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | NA | 8.41E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | 2.27E-09 | NA | mr1301 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | 1.36E-07 | 4.12E-16 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | 6.07E-13 | 8.52E-14 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | 2.64E-07 | 6.73E-14 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | NA | 6.37E-33 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | NA | 2.13E-07 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | 3.31E-11 | NA | mr1301_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | 6.84E-09 | 2.32E-17 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | 1.69E-16 | NA | mr1410_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | 2.68E-09 | 1.23E-14 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | NA | 3.04E-06 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518975375 | NA | 1.57E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |