\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518965804:

Variant ID: vg0518965804 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18965804
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, G: 0.34, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGCATATGTACCTACTGGTTCTACTGGTCGTGTGACTCAGTATTGGATTCCAAAATTTCTTATTTCTAACCCCAACACGAAGGCCTCGACATCTCCTC[T/G]
TTCGTAGGTATTTTGGCGGCATACTCCCCATGAGCGTTCAATGTTGAGATGATGATTGCTTTTCAAGGTAACATCAATTTACTTTTGGATTGACATATTT

Reverse complement sequence

AAATATGTCAATCCAAAAGTAAATTGATGTTACCTTGAAAAGCAATCATCATCTCAACATTGAACGCTCATGGGGAGTATGCCGCCAAAATACCTACGAA[A/C]
GAGGAGATGTCGAGGCCTTCGTGTTGGGGTTAGAAATAAGAAATTTTGGAATCCAATACTGAGTCACACGACCAGTAGAACCAGTAGGTACATATGCACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.70% 13.40% 1.04% 54.91% NA
All Indica  2759 1.80% 7.10% 1.67% 89.34% NA
All Japonica  1512 84.30% 12.20% 0.00% 3.51% NA
Aus  269 0.70% 84.00% 0.37% 14.87% NA
Indica I  595 1.30% 0.70% 0.67% 97.31% NA
Indica II  465 1.90% 28.40% 1.29% 68.39% NA
Indica III  913 1.50% 1.10% 1.53% 95.84% NA
Indica Intermediate  786 2.50% 6.50% 2.80% 88.17% NA
Temperate Japonica  767 94.90% 1.70% 0.00% 3.39% NA
Tropical Japonica  504 67.10% 28.20% 0.00% 4.76% NA
Japonica Intermediate  241 86.30% 12.40% 0.00% 1.24% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 36.70% 20.00% 2.22% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518965804 T -> DEL N N silent_mutation Average:12.177; most accessible tissue: Callus, score: 43.671 N N N N
vg0518965804 T -> G LOC_Os05g32480.1 upstream_gene_variant ; 4536.0bp to feature; MODIFIER silent_mutation Average:12.177; most accessible tissue: Callus, score: 43.671 N N N N
vg0518965804 T -> G LOC_Os05g32474.1 downstream_gene_variant ; 3416.0bp to feature; MODIFIER silent_mutation Average:12.177; most accessible tissue: Callus, score: 43.671 N N N N
vg0518965804 T -> G LOC_Os05g32470.1 intron_variant ; MODIFIER silent_mutation Average:12.177; most accessible tissue: Callus, score: 43.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518965804 NA 6.66E-16 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 1.76E-06 mr1304 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 1.15E-07 1.15E-07 mr1377 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 1.77E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 1.12E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 1.65E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 1.41E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 1.45E-06 mr1986 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 5.92E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 1.12E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 1.47E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 2.58E-06 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 9.06E-07 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 7.66E-07 mr1333_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 6.49E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 8.36E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 2.46E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 4.21E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 2.00E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518965804 NA 2.94E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251