\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518964784:

Variant ID: vg0518964784 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18964784
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTGCTTTACATGCTCGTGTTGTTGATGAGTTAATTTTGACAAAGAACGTTTTGAAAAAAATACAAAGTTGTTTTTTGTGCAAGTTCTTTGGTCAATG[T/C]
TTCGTGTGCAAATAAGGCAAAACAAAACAATGGTGTTTTGTTTTCTCAAGATTGTTCAAAGTGTGTTTTGAATGAGTTGAAGTTGAAAGATGCTTTAGGG

Reverse complement sequence

CCCTAAAGCATCTTTCAACTTCAACTCATTCAAAACACACTTTGAACAATCTTGAGAAAACAAAACACCATTGTTTTGTTTTGCCTTATTTGCACACGAA[A/G]
CATTGACCAAAGAACTTGCACAAAAAACAACTTTGTATTTTTTTCAAAACGTTCTTTGTCAAAATTAACTCATCAACAACACGAGCATGTAAAGCAAATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.70% 16.10% 1.97% 53.28% NA
All Indica  2759 3.10% 7.10% 3.08% 86.70% NA
All Japonica  1512 75.90% 20.40% 0.26% 3.51% NA
Aus  269 1.10% 83.60% 0.37% 14.87% NA
Indica I  595 2.20% 0.50% 2.69% 94.62% NA
Indica II  465 4.50% 28.40% 2.37% 64.73% NA
Indica III  913 2.30% 1.10% 4.27% 92.33% NA
Indica Intermediate  786 3.80% 6.60% 2.42% 87.15% NA
Temperate Japonica  767 87.70% 8.60% 0.13% 3.52% NA
Tropical Japonica  504 63.70% 31.70% 0.00% 4.56% NA
Japonica Intermediate  241 63.50% 34.00% 1.24% 1.24% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 35.60% 24.40% 3.33% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518964784 T -> DEL N N silent_mutation Average:5.476; most accessible tissue: Callus, score: 15.571 N N N N
vg0518964784 T -> C LOC_Os05g32460.1 upstream_gene_variant ; 4637.0bp to feature; MODIFIER silent_mutation Average:5.476; most accessible tissue: Callus, score: 15.571 N N N N
vg0518964784 T -> C LOC_Os05g32474.1 downstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:5.476; most accessible tissue: Callus, score: 15.571 N N N N
vg0518964784 T -> C LOC_Os05g32470.1 intron_variant ; MODIFIER silent_mutation Average:5.476; most accessible tissue: Callus, score: 15.571 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518964784 3.94E-06 2.68E-07 mr1514 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 8.38E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 2.66E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 4.89E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 2.81E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 8.57E-06 mr1986 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 1.64E-08 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 9.42E-07 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 1.41E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 8.73E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 3.18E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 6.34E-08 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518964784 NA 9.90E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251