\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518903242:

Variant ID: vg0518903242 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18903242
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GCATATATATGTACGTACGATTTCGATGGATCTCGCAAATCTGAACAAGGTGACAGCACAATCCGGGCTCGAAGTGACGGTACTCGCTTTGGCTGATTCA[C/T]
CGGTGGCCAAAGATCTCACATTGTCTGTGAAACTCCACGGCCTTTTTATTTTTGCCGGCCAACTTTGTCTGAAACCCCAGCATATCATCCAGGGGCAAAG

Reverse complement sequence

CTTTGCCCCTGGATGATATGCTGGGGTTTCAGACAAAGTTGGCCGGCAAAAATAAAAAGGCCGTGGAGTTTCACAGACAATGTGAGATCTTTGGCCACCG[G/A]
TGAATCAGCCAAAGCGAGTACCGTCACTTCGAGCCCGGATTGTGCTGTCACCTTGTTCAGATTTGCGAGATCCATCGAAATCGTACGTACATATATATGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 45.70% 0.11% 0.25% NA
All Indica  2759 72.10% 27.40% 0.07% 0.43% NA
All Japonica  1512 15.70% 84.30% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 39.00% 60.70% 0.00% 0.34% NA
Indica II  465 88.80% 10.80% 0.22% 0.22% NA
Indica III  913 74.50% 24.90% 0.00% 0.66% NA
Indica Intermediate  786 84.60% 14.90% 0.13% 0.38% NA
Temperate Japonica  767 5.00% 94.90% 0.13% 0.00% NA
Tropical Japonica  504 32.90% 67.10% 0.00% 0.00% NA
Japonica Intermediate  241 13.70% 86.30% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518903242 C -> T LOC_Os05g32400.1 upstream_gene_variant ; 177.0bp to feature; MODIFIER silent_mutation Average:87.591; most accessible tissue: Minghui63 flower, score: 96.461 N N N N
vg0518903242 C -> T LOC_Os05g32390.1 downstream_gene_variant ; 2380.0bp to feature; MODIFIER silent_mutation Average:87.591; most accessible tissue: Minghui63 flower, score: 96.461 N N N N
vg0518903242 C -> T LOC_Os05g32390-LOC_Os05g32400 intergenic_region ; MODIFIER silent_mutation Average:87.591; most accessible tissue: Minghui63 flower, score: 96.461 N N N N
vg0518903242 C -> DEL N N silent_mutation Average:87.591; most accessible tissue: Minghui63 flower, score: 96.461 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0518903242 C T -0.07 -0.02 -0.04 -0.09 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518903242 NA 5.13E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518903242 NA 3.62E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518903242 NA 2.55E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518903242 NA 1.32E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518903242 7.60E-06 NA mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518903242 8.85E-06 NA mr1398_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518903242 1.76E-06 2.76E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251