Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518884062:

Variant ID: vg0518884062 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18884062
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTTCAAACTTTTAACTTTTCCATCCCATCAAAACTTTCCTACACACATAAACTTCTAACTTTTCTATCACATCATTCCAATTTTAATTAAACTTT[T/C]
AATTTTGACGTGAACTAAACACACCCTAAGACTTCGCAATATGATCAGTACAGTATAATATGTGAGTTGTGGGGTGTGTTTAGTTCACACAAAAATTAGA

Reverse complement sequence

TCTAATTTTTGTGTGAACTAAACACACCCCACAACTCACATATTATACTGTACTGATCATATTGCGAAGTCTTAGGGTGTGTTTAGTTCACGTCAAAATT[A/G]
AAAGTTTAATTAAAATTGGAATGATGTGATAGAAAAGTTAGAAGTTTATGTGTGTAGGAAAGTTTTGATGGGATGGAAAAGTTAAAAGTTTGAAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 9.60% 1.84% 0.00% NA
All Indica  2759 99.20% 0.70% 0.14% 0.00% NA
All Japonica  1512 66.70% 28.00% 5.29% 0.00% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.40% 0.25% 0.00% NA
Temperate Japonica  767 39.20% 52.20% 8.60% 0.00% NA
Tropical Japonica  504 96.80% 1.20% 1.98% 0.00% NA
Japonica Intermediate  241 91.30% 7.10% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518884062 T -> C LOC_Os05g32380.1 intron_variant ; MODIFIER silent_mutation Average:86.598; most accessible tissue: Zhenshan97 root, score: 92.561 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0518884062 T C -0.04 -0.03 -0.04 -0.05 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518884062 NA 1.57E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0518884062 5.83E-06 NA mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 5.16E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 5.25E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 8.59E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 1.27E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 7.89E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 8.47E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 5.55E-06 mr1397 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 1.38E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 4.14E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 6.51E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 3.34E-07 1.08E-25 mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 2.91E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518884062 NA 4.85E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251