\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518660776:

Variant ID: vg0518660776 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18660776
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.52, T: 0.48, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAGTGTCCGATAAGGACTTTATATTTTCCTTTTATCTTTAGGTTAGTTTCTTTCTTGTCTGACAAGGACTTGTATCAACCCATGGGTATAAATATGTA[T/C]
ACCCGGGGTCTATGTAATCTATCGCTACGATCAATATATTTCGGCGCATCGCCACCCTTTTACCTTTTCTACTTTTGTTTTTTACGTTCCGGCGGAACTT

Reverse complement sequence

AAGTTCCGCCGGAACGTAAAAAACAAAAGTAGAAAAGGTAAAAGGGTGGCGATGCGCCGAAATATATTGATCGTAGCGATAGATTACATAGACCCCGGGT[A/G]
TACATATTTATACCCATGGGTTGATACAAGTCCTTGTCAGACAAGAAAGAAACTAACCTAAAGATAAAAGGAAAATATAAAGTCCTTATCGGACACTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 35.80% 21.71% 5.50% NA
All Indica  2759 54.00% 3.40% 34.40% 8.23% NA
All Japonica  1512 0.70% 96.60% 1.39% 1.32% NA
Aus  269 82.20% 1.90% 12.64% 3.35% NA
Indica I  595 71.40% 2.90% 17.98% 7.73% NA
Indica II  465 43.00% 4.70% 42.15% 10.11% NA
Indica III  913 59.60% 2.50% 34.39% 3.50% NA
Indica Intermediate  786 40.70% 4.10% 42.24% 12.98% NA
Temperate Japonica  767 0.10% 96.50% 1.96% 1.43% NA
Tropical Japonica  504 1.80% 95.80% 0.99% 1.39% NA
Japonica Intermediate  241 0.40% 98.30% 0.41% 0.83% NA
VI/Aromatic  96 3.10% 95.80% 1.04% 0.00% NA
Intermediate  90 24.40% 47.80% 23.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518660776 T -> DEL N N silent_mutation Average:25.647; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg0518660776 T -> C LOC_Os05g32020.1 upstream_gene_variant ; 2925.0bp to feature; MODIFIER silent_mutation Average:25.647; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg0518660776 T -> C LOC_Os05g32030.1 upstream_gene_variant ; 2664.0bp to feature; MODIFIER silent_mutation Average:25.647; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg0518660776 T -> C LOC_Os05g32010.1 downstream_gene_variant ; 4176.0bp to feature; MODIFIER silent_mutation Average:25.647; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg0518660776 T -> C LOC_Os05g32020-LOC_Os05g32030 intergenic_region ; MODIFIER silent_mutation Average:25.647; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518660776 4.61E-06 NA mr1973 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518660776 NA 6.13E-08 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518660776 NA 3.62E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251