\
| Variant ID: vg0518537224 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 18537224 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGTTTTCAAGTCCAATGCACACTCTCCCGTGCTTTCTCTACTCTCTCTTTCACATAACACTTCCCCTAAAATTTCTGTGTTTCAAAAGACATCACTTCTA[T/A]
TGTTAGGGAGCGTTGGTTCTGGTGAGTTAGGGTGAGAAAACACATCGTAGTCCGTGCGCACGCTTCCCAAACTACTAAACGGTGCGTTTTTGAAATTTAC
GTAAATTTCAAAAACGCACCGTTTAGTAGTTTGGGAAGCGTGCGCACGGACTACGATGTGTTTTCTCACCCTAACTCACCAGAACCAACGCTCCCTAACA[A/T]
TAGAAGTGATGTCTTTTGAAACACAGAAATTTTAGGGGAAGTGTTATGTGAAAGAGAGAGTAGAGAAAGCACGGGAGAGTGTGCATTGGACTTGAAAACG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.60% | 35.10% | 0.13% | 5.16% | NA |
| All Indica | 2759 | 96.30% | 1.50% | 0.07% | 2.14% | NA |
| All Japonica | 1512 | 3.30% | 96.60% | 0.00% | 0.07% | NA |
| Aus | 269 | 23.00% | 9.30% | 0.00% | 67.66% | NA |
| Indica I | 595 | 99.00% | 0.20% | 0.00% | 0.84% | NA |
| Indica II | 465 | 96.60% | 2.80% | 0.22% | 0.43% | NA |
| Indica III | 913 | 96.10% | 1.10% | 0.00% | 2.85% | NA |
| Indica Intermediate | 786 | 94.40% | 2.20% | 0.13% | 3.31% | NA |
| Temperate Japonica | 767 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.40% | 95.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.30% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 1.00% | 96.90% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 54.40% | 41.10% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0518537224 | T -> DEL | N | N | silent_mutation | Average:53.181; most accessible tissue: Callus, score: 71.784 | N | N | N | N |
| vg0518537224 | T -> A | LOC_Os05g31830.1 | upstream_gene_variant ; 341.0bp to feature; MODIFIER | silent_mutation | Average:53.181; most accessible tissue: Callus, score: 71.784 | N | N | N | N |
| vg0518537224 | T -> A | LOC_Os05g31850.1 | upstream_gene_variant ; 4913.0bp to feature; MODIFIER | silent_mutation | Average:53.181; most accessible tissue: Callus, score: 71.784 | N | N | N | N |
| vg0518537224 | T -> A | LOC_Os05g31820.1 | downstream_gene_variant ; 2547.0bp to feature; MODIFIER | silent_mutation | Average:53.181; most accessible tissue: Callus, score: 71.784 | N | N | N | N |
| vg0518537224 | T -> A | LOC_Os05g31840.1 | downstream_gene_variant ; 504.0bp to feature; MODIFIER | silent_mutation | Average:53.181; most accessible tissue: Callus, score: 71.784 | N | N | N | N |
| vg0518537224 | T -> A | LOC_Os05g31830-LOC_Os05g31840 | intergenic_region ; MODIFIER | silent_mutation | Average:53.181; most accessible tissue: Callus, score: 71.784 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0518537224 | NA | 3.02E-21 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518537224 | NA | 5.16E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518537224 | NA | 1.44E-66 | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518537224 | NA | 8.22E-23 | mr1541 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518537224 | NA | 1.03E-29 | mr1737 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |