\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518537224:

Variant ID: vg0518537224 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18537224
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTTTTCAAGTCCAATGCACACTCTCCCGTGCTTTCTCTACTCTCTCTTTCACATAACACTTCCCCTAAAATTTCTGTGTTTCAAAAGACATCACTTCTA[T/A]
TGTTAGGGAGCGTTGGTTCTGGTGAGTTAGGGTGAGAAAACACATCGTAGTCCGTGCGCACGCTTCCCAAACTACTAAACGGTGCGTTTTTGAAATTTAC

Reverse complement sequence

GTAAATTTCAAAAACGCACCGTTTAGTAGTTTGGGAAGCGTGCGCACGGACTACGATGTGTTTTCTCACCCTAACTCACCAGAACCAACGCTCCCTAACA[A/T]
TAGAAGTGATGTCTTTTGAAACACAGAAATTTTAGGGGAAGTGTTATGTGAAAGAGAGAGTAGAGAAAGCACGGGAGAGTGTGCATTGGACTTGAAAACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 35.10% 0.13% 5.16% NA
All Indica  2759 96.30% 1.50% 0.07% 2.14% NA
All Japonica  1512 3.30% 96.60% 0.00% 0.07% NA
Aus  269 23.00% 9.30% 0.00% 67.66% NA
Indica I  595 99.00% 0.20% 0.00% 0.84% NA
Indica II  465 96.60% 2.80% 0.22% 0.43% NA
Indica III  913 96.10% 1.10% 0.00% 2.85% NA
Indica Intermediate  786 94.40% 2.20% 0.13% 3.31% NA
Temperate Japonica  767 3.30% 96.70% 0.00% 0.00% NA
Tropical Japonica  504 4.40% 95.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.41% NA
VI/Aromatic  96 1.00% 96.90% 1.04% 1.04% NA
Intermediate  90 54.40% 41.10% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518537224 T -> DEL N N silent_mutation Average:53.181; most accessible tissue: Callus, score: 71.784 N N N N
vg0518537224 T -> A LOC_Os05g31830.1 upstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:53.181; most accessible tissue: Callus, score: 71.784 N N N N
vg0518537224 T -> A LOC_Os05g31850.1 upstream_gene_variant ; 4913.0bp to feature; MODIFIER silent_mutation Average:53.181; most accessible tissue: Callus, score: 71.784 N N N N
vg0518537224 T -> A LOC_Os05g31820.1 downstream_gene_variant ; 2547.0bp to feature; MODIFIER silent_mutation Average:53.181; most accessible tissue: Callus, score: 71.784 N N N N
vg0518537224 T -> A LOC_Os05g31840.1 downstream_gene_variant ; 504.0bp to feature; MODIFIER silent_mutation Average:53.181; most accessible tissue: Callus, score: 71.784 N N N N
vg0518537224 T -> A LOC_Os05g31830-LOC_Os05g31840 intergenic_region ; MODIFIER silent_mutation Average:53.181; most accessible tissue: Callus, score: 71.784 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518537224 NA 3.02E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518537224 NA 5.16E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518537224 NA 1.44E-66 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518537224 NA 8.22E-23 mr1541 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518537224 NA 1.03E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251