Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518537224:

Variant ID: vg0518537224 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 18537224
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTTTTCAAGTCCAATGCACACTCTCCCGTGCTTTCTCTACTCTCTCTTTCACATAACACTTCCCCTAAAATTTCTGTGTTTCAAAAGACATCACTTCTA[T/A]
TGTTAGGGAGCGTTGGTTCTGGTGAGTTAGGGTGAGAAAACACATCGTAGTCCGTGCGCACGCTTCCCAAACTACTAAACGGTGCGTTTTTGAAATTTAC

Reverse complement sequence

GTAAATTTCAAAAACGCACCGTTTAGTAGTTTGGGAAGCGTGCGCACGGACTACGATGTGTTTTCTCACCCTAACTCACCAGAACCAACGCTCCCTAACA[A/T]
TAGAAGTGATGTCTTTTGAAACACAGAAATTTTAGGGGAAGTGTTATGTGAAAGAGAGAGTAGAGAAAGCACGGGAGAGTGTGCATTGGACTTGAAAACG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	35.10%	0.13%	5.16%	NA
All Indica	2759	96.30%	1.50%	0.07%	2.14%	NA
All Japonica	1512	3.30%	96.60%	0.00%	0.07%	NA
Aus	269	23.00%	9.30%	0.00%	67.66%	NA
Indica I	595	99.00%	0.20%	0.00%	0.84%	NA
Indica II	465	96.60%	2.80%	0.22%	0.43%	NA
Indica III	913	96.10%	1.10%	0.00%	2.85%	NA
Indica Intermediate	786	94.40%	2.20%	0.13%	3.31%	NA
Temperate Japonica	767	3.30%	96.70%	0.00%	0.00%	NA
Tropical Japonica	504	4.40%	95.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.30%	0.00%	0.41%	NA
VI/Aromatic	96	1.00%	96.90%	1.04%	1.04%	NA
Intermediate	90	54.40%	41.10%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0518537224	T -> DEL	N	N	silent_mutation	Average:53.181; most accessible tissue: Callus, score: 71.784	N	N	N	N
vg0518537224	T -> A	LOC_Os05g31830.1	upstream_gene_variant ; 341.0bp to feature; MODIFIER	silent_mutation	Average:53.181; most accessible tissue: Callus, score: 71.784	N	N	N	N
vg0518537224	T -> A	LOC_Os05g31850.1	upstream_gene_variant ; 4913.0bp to feature; MODIFIER	silent_mutation	Average:53.181; most accessible tissue: Callus, score: 71.784	N	N	N	N
vg0518537224	T -> A	LOC_Os05g31820.1	downstream_gene_variant ; 2547.0bp to feature; MODIFIER	silent_mutation	Average:53.181; most accessible tissue: Callus, score: 71.784	N	N	N	N
vg0518537224	T -> A	LOC_Os05g31840.1	downstream_gene_variant ; 504.0bp to feature; MODIFIER	silent_mutation	Average:53.181; most accessible tissue: Callus, score: 71.784	N	N	N	N
vg0518537224	T -> A	LOC_Os05g31830-LOC_Os05g31840	intergenic_region ; MODIFIER	silent_mutation	Average:53.181; most accessible tissue: Callus, score: 71.784	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0518537224	NA	3.02E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518537224	NA	5.16E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518537224	NA	1.44E-66	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518537224	NA	8.22E-23	mr1541	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518537224	NA	1.03E-29	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251