\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518442916:

Variant ID: vg0518442916 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18442916
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACGGTTTCCCTTTTATTTCCCTTATTATTTCTCTTCCCCTTACTCTATCGCCGTCAGAGGAGAGACACCACACCGAGGCGGAGAATATTTGATGTTTT[A/C]
AGTTCAATTCAAACTTAGAAGCTTGTAGACTTTTTGTTCCACTGCTTTTGTTGTGGCGGGTAAACAGGCACGCCCGCGGGCACAAGGCGCCCGCGGGCAA

Reverse complement sequence

TTGCCCGCGGGCGCCTTGTGCCCGCGGGCGTGCCTGTTTACCCGCCACAACAAAAGCAGTGGAACAAAAAGTCTACAAGCTTCTAAGTTTGAATTGAACT[T/G]
AAAACATCAAATATTCTCCGCCTCGGTGTGGTGTCTCTCCTCTGACGGCGATAGAGTAAGGGGAAGAGAAATAATAAGGGAAATAAAAGGGAAACCGTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 4.00% 2.05% 33.41% NA
All Indica  2759 42.50% 0.50% 3.26% 53.72% NA
All Japonica  1512 97.50% 0.00% 0.07% 2.45% NA
Aus  269 20.10% 62.50% 1.12% 16.36% NA
Indica I  595 10.40% 0.00% 2.18% 87.39% NA
Indica II  465 89.50% 0.20% 1.72% 8.60% NA
Indica III  913 35.20% 0.50% 3.83% 60.46% NA
Indica Intermediate  786 47.60% 1.00% 4.33% 47.07% NA
Temperate Japonica  767 99.20% 0.00% 0.00% 0.78% NA
Tropical Japonica  504 94.00% 0.00% 0.00% 5.95% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 77.80% 1.10% 3.33% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518442916 A -> DEL N N silent_mutation Average:53.576; most accessible tissue: Minghui63 young leaf, score: 94.914 N N N N
vg0518442916 A -> C LOC_Os05g31680-LOC_Os05g31690 intergenic_region ; MODIFIER silent_mutation Average:53.576; most accessible tissue: Minghui63 young leaf, score: 94.914 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0518442916 A C 0.04 0.04 0.05 0.06 0.1 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518442916 NA 5.18E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 4.10E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 6.55E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 1.04E-06 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 9.72E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 6.67E-23 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 9.69E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 1.19E-16 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 1.37E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 1.28E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 2.24E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 9.10E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 6.58E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 2.39E-11 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 2.14E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 9.48E-07 mr1952 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 1.13E-09 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 4.03E-22 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 3.64E-17 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 9.48E-23 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 1.00E-07 NA mr1550_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 2.71E-10 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 2.72E-16 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518442916 NA 4.32E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251