\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518432302:

Variant ID: vg0518432302 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18432302
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.01, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTCACGTCCTCCTGCATATGAAATTGATCTACTTAATCTAGGTTGCGAGATAACTACTTTCCATAACAATGGATACCAGTTGATACTTTTCCCCATTC[C/T]
ATAATATAAGACTTGTTTCATAATATAGAGCATGTATGTATGCATGCCATTAACTAGGAAATTTTTTTCACTAAAATATTATTATTTAAATCTTCTACCT

Reverse complement sequence

AGGTAGAAGATTTAAATAATAATATTTTAGTGAAAAAAATTTCCTAGTTAATGGCATGCATACATACATGCTCTATATTATGAAACAAGTCTTATATTAT[G/A]
GAATGGGGAAAAGTATCAACTGGTATCCATTGTTATGGAAAGTAGTTATCTCGCAACCTAGATTAAGTAGATCAATTTCATATGCAGGAGGACGTGACCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.80% 30.30% 0.93% 0.00% NA
All Indica  2759 47.60% 50.80% 1.56% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 36.80% 62.90% 0.34% 0.00% NA
Indica II  465 60.00% 39.60% 0.43% 0.00% NA
Indica III  913 45.50% 51.40% 3.18% 0.00% NA
Indica Intermediate  786 51.00% 47.70% 1.27% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518432302 C -> T LOC_Os05g31660.1 upstream_gene_variant ; 3469.0bp to feature; MODIFIER silent_mutation Average:76.738; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0518432302 C -> T LOC_Os05g31670.1 upstream_gene_variant ; 2009.0bp to feature; MODIFIER silent_mutation Average:76.738; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0518432302 C -> T LOC_Os05g31680.1 upstream_gene_variant ; 1009.0bp to feature; MODIFIER silent_mutation Average:76.738; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0518432302 C -> T LOC_Os05g31670-LOC_Os05g31680 intergenic_region ; MODIFIER silent_mutation Average:76.738; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518432302 NA 5.54E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 2.89E-07 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 1.92E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 6.28E-10 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 1.86E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 7.15E-07 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 1.06E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 4.19E-06 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 4.99E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 9.91E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 6.00E-06 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 3.49E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 2.99E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 3.46E-06 mr1504 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 2.41E-06 mr1528 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 8.58E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 3.65E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 3.00E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 3.21E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 1.11E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 9.70E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 7.02E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 8.54E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 6.09E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518432302 NA 5.39E-07 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251