\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518422633:

Variant ID: vg0518422633 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18422633
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


GGACAAGAAGGAGTGCTCTTGTAGGTATTGGCAGCTCTTAGGATTACCATGCCCTCATGCTATATCATGCATATTCTATAGAACAAATAAGCTAGATGAC[T/C]
ATATTGCACCTTGTTACTATGTGGATGCATTTAGAAGCACATATGTGCATTGCCTTCAGCCATTGGAAGGAATGAGTGCTTGGCCACAGGATGATAGGGA

Reverse complement sequence

TCCCTATCATCCTGTGGCCAAGCACTCATTCCTTCCAATGGCTGAAGGCAATGCACATATGTGCTTCTAAATGCATCCACATAGTAACAAGGTGCAATAT[A/G]
GTCATCTAGCTTATTTGTTCTATAGAATATGCATGATATAGCATGAGGGCATGGTAATCCTAAGAGCTGCCAATACCTACAAGAGCACTCCTTCTTGTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 14.70% 1.16% 0.70% NA
All Indica  2759 95.00% 3.90% 0.51% 0.62% NA
All Japonica  1512 64.90% 31.90% 2.45% 0.73% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 78.10% 17.40% 2.15% 2.37% NA
Indica III  913 99.50% 0.40% 0.11% 0.00% NA
Indica Intermediate  786 95.90% 2.90% 0.38% 0.76% NA
Temperate Japonica  767 94.10% 3.70% 1.96% 0.26% NA
Tropical Japonica  504 22.80% 73.00% 2.58% 1.59% NA
Japonica Intermediate  241 60.20% 35.70% 3.73% 0.41% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 68.90% 21.10% 4.44% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518422633 T -> DEL LOC_Os05g31630.1 N frameshift_variant Average:46.379; most accessible tissue: Zhenshan97 root, score: 64.045 N N N N
vg0518422633 T -> C LOC_Os05g31630.1 missense_variant ; p.Tyr862His; MODERATE nonsynonymous_codon ; Y862H Average:46.379; most accessible tissue: Zhenshan97 root, score: 64.045 probably damaging 2.579 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518422633 NA 7.05E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 4.61E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 2.22E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 1.69E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 1.23E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 1.20E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 2.16E-10 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 4.61E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 4.59E-09 mr1584 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 1.69E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 5.59E-07 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 2.64E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 1.18E-06 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 1.07E-06 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 1.63E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 4.44E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 3.35E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 3.63E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 4.31E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 3.57E-14 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 3.45E-10 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633 NA 1.76E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251