Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518422633:

Variant ID: vg0518422633 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 18422633
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

GGACAAGAAGGAGTGCTCTTGTAGGTATTGGCAGCTCTTAGGATTACCATGCCCTCATGCTATATCATGCATATTCTATAGAACAAATAAGCTAGATGAC[T/C]
ATATTGCACCTTGTTACTATGTGGATGCATTTAGAAGCACATATGTGCATTGCCTTCAGCCATTGGAAGGAATGAGTGCTTGGCCACAGGATGATAGGGA

Reverse complement sequence

TCCCTATCATCCTGTGGCCAAGCACTCATTCCTTCCAATGGCTGAAGGCAATGCACATATGTGCTTCTAAATGCATCCACATAGTAACAAGGTGCAATAT[A/G]
GTCATCTAGCTTATTTGTTCTATAGAATATGCATGATATAGCATGAGGGCATGGTAATCCTAAGAGCTGCCAATACCTACAAGAGCACTCCTTCTTGTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.50%	14.70%	1.16%	0.70%	NA
All Indica	2759	95.00%	3.90%	0.51%	0.62%	NA
All Japonica	1512	64.90%	31.90%	2.45%	0.73%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	78.10%	17.40%	2.15%	2.37%	NA
Indica III	913	99.50%	0.40%	0.11%	0.00%	NA
Indica Intermediate	786	95.90%	2.90%	0.38%	0.76%	NA
Temperate Japonica	767	94.10%	3.70%	1.96%	0.26%	NA
Tropical Japonica	504	22.80%	73.00%	2.58%	1.59%	NA
Japonica Intermediate	241	60.20%	35.70%	3.73%	0.41%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	68.90%	21.10%	4.44%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0518422633	T -> DEL	LOC_Os05g31630.1	N	frameshift_variant	Average:46.379; most accessible tissue: Zhenshan97 root, score: 64.045	N	N	N	N
vg0518422633	T -> C	LOC_Os05g31630.1	missense_variant ; p.Tyr862His; MODERATE	nonsynonymous_codon ; Y862H	Average:46.379; most accessible tissue: Zhenshan97 root, score: 64.045	probably damaging	2.579	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0518422633	NA	7.05E-07	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	4.61E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	2.22E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	1.69E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	1.23E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	1.20E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	2.16E-10	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	4.61E-06	mr1578	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	4.59E-09	mr1584	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	1.69E-09	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	5.59E-07	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	2.64E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	1.18E-06	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	1.07E-06	mr1819	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	1.63E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	4.44E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	3.35E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	3.63E-08	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	4.31E-06	mr1567_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	3.57E-14	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	3.45E-10	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518422633	NA	1.76E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251