\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518412104:

Variant ID: vg0518412104 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18412104
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CCACTCCCTCCGTTCCATAATATAAGGGATTTTTGACTTTTTCTTGCATTGTTTAATCGCTCGTTTTATTTAAATATTTTGTGCAAATATAAAAAACGAA[A/G]
AGATGTGCTTAAAGTACTTTGGATAATAAAGTACTTTGGATAATAAAGTAAGTCATAAATAAAATAAATAATAATTTTAAATTTTTTAAATAAGACGAAT

Reverse complement sequence

ATTCGTCTTATTTAAAAAATTTAAAATTATTATTTATTTTATTTATGACTTACTTTATTATCCAAAGTACTTTATTATCCAAAGTACTTTAAGCACATCT[T/C]
TTCGTTTTTTATATTTGCACAAAATATTTAAATAAAACGAGCGATTAAACAATGCAAGAAAAAGTCAAAAATCCCTTATATTATGGAACGGAGGGAGTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 45.60% 0.55% 0.00% NA
All Indica  2759 79.20% 19.90% 0.87% 0.00% NA
All Japonica  1512 3.30% 96.60% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 93.40% 3.70% 2.86% 0.00% NA
Indica II  465 45.60% 54.20% 0.22% 0.00% NA
Indica III  913 87.80% 11.90% 0.22% 0.00% NA
Indica Intermediate  786 78.20% 21.20% 0.51% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 7.10% 92.70% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 96.70% 0.41% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518412104 A -> G LOC_Os05g31620.1 upstream_gene_variant ; 4646.0bp to feature; MODIFIER silent_mutation Average:83.137; most accessible tissue: Zhenshan97 root, score: 92.392 N N N N
vg0518412104 A -> G LOC_Os05g31620-LOC_Os05g31630 intergenic_region ; MODIFIER silent_mutation Average:83.137; most accessible tissue: Zhenshan97 root, score: 92.392 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0518412104 A G 0.03 -0.04 -0.03 -0.02 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518412104 NA 8.14E-08 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 9.16E-07 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 3.32E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 4.79E-11 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 1.06E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 5.41E-06 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 2.22E-06 2.22E-06 mr1562 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 5.41E-06 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 3.00E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 1.04E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 1.54E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 7.30E-07 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 4.57E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 2.13E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 1.06E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518412104 NA 1.40E-18 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251