Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518392219:

Variant ID: vg0518392219 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 18392219
Reference Allele: CTCG	Alternative Allele: ATCG,C
Primary Allele: CTCG	Secondary Allele: ATCG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGGGTCCAATTGCCATCACCACTCTCCAACATTTATCCGCCATACCTCGCTCCAAGACAAATAATTCCCTTTGCCATGCCTGTCAGTTAGGGAAACACA[CTCG/ATCG,C]
TCTTCCTTTTAATAAGTCCACTTCCAGTACCTCTTCTCCTTTTGAACTTGTGCACTGCGATGTATGGACTTCTCCTGTTATGAGCATTTCTGGCTTCAAA

Reverse complement sequence

TTTGAAGCCAGAAATGCTCATAACAGGAGAAGTCCATACATCGCAGTGCACAAGTTCAAAAGGAGAAGAGGTACTGGAAGTGGACTTATTAAAAGGAAGA[CGAG/CGAT,G]
TGTGTTTCCCTAACTGACAGGCATGGCAAAGGGAATTATTTGTCTTGGAGCGAGGTATGGCGGATAAATGTTGGAGAGTGGTGATGGCAATTGGACCCGG

Allele Frequencies:

Populations	Population Size	Frequency of CTCG(primary allele)	Frequency of ATCG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.10%	9.10%	3.20%	45.56%	C: 0.04%
All Indica	2759	16.60%	4.90%	4.75%	73.76%	C: 0.04%
All Japonica	1512	77.10%	18.70%	0.93%	3.17%	C: 0.07%
Aus	269	83.30%	0.00%	0.37%	16.36%	NA
Indica I	595	6.90%	0.00%	6.39%	86.72%	NA
Indica II	465	38.10%	22.80%	5.59%	33.55%	NA
Indica III	913	12.20%	0.40%	2.96%	84.45%	NA
Indica Intermediate	786	16.40%	3.10%	5.09%	75.32%	C: 0.13%
Temperate Japonica	767	94.50%	2.90%	0.78%	1.83%	NA
Tropical Japonica	504	46.60%	46.00%	0.99%	6.35%	NA
Japonica Intermediate	241	85.50%	12.00%	1.24%	0.83%	C: 0.41%
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	52.20%	13.30%	5.56%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0518392219	CTCG -> DEL	N	N	silent_mutation	Average:8.46; most accessible tissue: Callus, score: 34.571	N	N	N	N
vg0518392219	CTCG -> C	LOC_Os05g31600.1	5_prime_UTR_variant ; 935.0bp to feature; MODIFIER	silent_mutation	Average:8.46; most accessible tissue: Callus, score: 34.571	N	N	N	N
vg0518392219	CTCG -> C	LOC_Os05g31610.1	upstream_gene_variant ; 4627.0bp to feature; MODIFIER	silent_mutation	Average:8.46; most accessible tissue: Callus, score: 34.571	N	N	N	N
vg0518392219	CTCG -> C	LOC_Os05g31590.1	downstream_gene_variant ; 730.0bp to feature; MODIFIER	silent_mutation	Average:8.46; most accessible tissue: Callus, score: 34.571	N	N	N	N
vg0518392219	CTCG -> ATCG	LOC_Os05g31600.1	5_prime_UTR_variant ; 940.0bp to feature; MODIFIER	silent_mutation	Average:8.46; most accessible tissue: Callus, score: 34.571	N	N	N	N
vg0518392219	CTCG -> ATCG	LOC_Os05g31610.1	upstream_gene_variant ; 4628.0bp to feature; MODIFIER	silent_mutation	Average:8.46; most accessible tissue: Callus, score: 34.571	N	N	N	N
vg0518392219	CTCG -> ATCG	LOC_Os05g31590.1	downstream_gene_variant ; 729.0bp to feature; MODIFIER	silent_mutation	Average:8.46; most accessible tissue: Callus, score: 34.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0518392219	NA	3.37E-06	mr1002	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	3.32E-08	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	2.71E-07	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	9.11E-06	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	3.34E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	7.79E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	6.49E-07	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	2.63E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	9.18E-08	mr1263	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	2.26E-18	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	5.10E-07	1.83E-16	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	9.46E-13	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	4.53E-06	mr1415	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	3.85E-06	mr1437	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	9.18E-08	mr1451	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	4.53E-06	mr1567	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	5.19E-06	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	1.50E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	6.43E-07	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	1.54E-08	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	9.23E-22	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	3.55E-15	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	6.62E-06	mr1399_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	2.04E-06	8.12E-18	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518392219	NA	1.07E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251