| Variant ID: vg0518363321 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 18363321 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCATGATGGTCAATCGTGATTGATTAATTAATTAATTTGCCAACTAAAATCTGATAATGATGGGTTGTGAACACATGGTTTTGATGGTCGTGCTCATGAC[A/G]
ATTAAGAACCGGTTCACGAGTTTCGGTTGTGAAACATTAACCGTGCCAACCACAAGCCAGCGTGGGCAACGGCTTTACCTTTTGTATAGCATGGTTCATT
AATGAACCATGCTATACAAAAGGTAAAGCCGTTGCCCACGCTGGCTTGTGGTTGGCACGGTTAATGTTTCACAACCGAAACTCGTGAACCGGTTCTTAAT[T/C]
GTCATGAGCACGACCATCAAAACCATGTGTTCACAACCCATCATTATCAGATTTTAGTTGGCAAATTAATTAATTAATCAATCACGATTGACCATCATGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.30% | 0.40% | 10.50% | 16.89% | NA |
| All Indica | 2759 | 64.70% | 0.50% | 12.32% | 22.44% | NA |
| All Japonica | 1512 | 92.30% | 0.10% | 2.25% | 5.42% | NA |
| Aus | 269 | 28.30% | 0.70% | 40.52% | 30.48% | NA |
| Indica I | 595 | 70.80% | 0.20% | 4.71% | 24.37% | NA |
| Indica II | 465 | 61.90% | 0.60% | 18.06% | 19.35% | NA |
| Indica III | 913 | 63.20% | 0.70% | 13.80% | 22.34% | NA |
| Indica Intermediate | 786 | 63.60% | 0.50% | 12.98% | 22.90% | NA |
| Temperate Japonica | 767 | 97.70% | 0.00% | 0.78% | 1.56% | NA |
| Tropical Japonica | 504 | 86.50% | 0.00% | 3.17% | 10.32% | NA |
| Japonica Intermediate | 241 | 87.10% | 0.40% | 4.98% | 7.47% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 5.21% | 1.04% | NA |
| Intermediate | 90 | 75.60% | 0.00% | 8.89% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0518363321 | A -> DEL | N | N | silent_mutation | Average:26.055; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0518363321 | A -> G | LOC_Os05g31560.1 | downstream_gene_variant ; 357.0bp to feature; MODIFIER | silent_mutation | Average:26.055; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0518363321 | A -> G | LOC_Os05g31560-LOC_Os05g31570 | intergenic_region ; MODIFIER | silent_mutation | Average:26.055; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0518363321 | 8.75E-07 | 5.39E-06 | mr1021 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518363321 | 1.22E-07 | NA | mr1165 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518363321 | 4.31E-08 | 1.33E-07 | mr1165 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518363321 | 7.68E-06 | NA | mr1471 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518363321 | 1.81E-06 | 8.49E-06 | mr1477 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518363321 | 4.12E-07 | NA | mr1478 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518363321 | 4.39E-07 | 1.91E-06 | mr1478 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518363321 | NA | 6.85E-06 | mr1590 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518363321 | NA | 2.31E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518363321 | 1.11E-06 | 9.04E-06 | mr1815 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |