Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518335953:

Variant ID: vg0518335953 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 18335953
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:

CAGCATTACGCATTCCTCGAACAATGAAATTTGTGGAACATCAATAGCTTTACATGACAAGTAAAGATGAAGCGATTATTCAAAATAACACAAATTTTTT[T/C]
CACTTTCTAGTTTCCAGAGCATGAAAATAAAAGTGATGGCATAAAATCAGAACATAAGTAAAAAAAATCATTCAGAAAGTTAGATTGCTTGAAGAAGAGA

Reverse complement sequence

TCTCTTCTTCAAGCAATCTAACTTTCTGAATGATTTTTTTTACTTATGTTCTGATTTTATGCCATCACTTTTATTTTCATGCTCTGGAAACTAGAAAGTG[A/G]
AAAAAATTTGTGTTATTTTGAATAATCGCTTCATCTTTACTTGTCATGTAAAGCTATTGATGTTCCACAAATTTCATTGTTCGAGGAATGCGTAATGCTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.80%	36.20%	4.10%	3.85%	NA
All Indica	2759	87.40%	6.60%	1.12%	4.82%	NA
All Japonica	1512	4.70%	92.90%	0.00%	2.45%	NA
Aus	269	39.80%	0.00%	57.62%	2.60%	NA
Indica I	595	97.00%	2.50%	0.17%	0.34%	NA
Indica II	465	48.20%	26.20%	2.80%	22.80%	NA
Indica III	913	98.80%	0.80%	0.44%	0.00%	NA
Indica Intermediate	786	90.20%	5.00%	1.65%	3.18%	NA
Temperate Japonica	767	3.50%	95.60%	0.00%	0.91%	NA
Tropical Japonica	504	7.50%	92.30%	0.00%	0.20%	NA
Japonica Intermediate	241	2.50%	85.50%	0.00%	12.03%	NA
VI/Aromatic	96	6.20%	88.50%	5.21%	0.00%	NA
Intermediate	90	45.60%	45.60%	3.33%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0518335953	T -> DEL	N	N	silent_mutation	Average:35.714; most accessible tissue: Callus, score: 53.386	N	N	N	N
vg0518335953	T -> C	LOC_Os05g31525.1	upstream_gene_variant ; 4358.0bp to feature; MODIFIER	silent_mutation	Average:35.714; most accessible tissue: Callus, score: 53.386	N	N	N	N
vg0518335953	T -> C	LOC_Os05g31510.1	downstream_gene_variant ; 4275.0bp to feature; MODIFIER	silent_mutation	Average:35.714; most accessible tissue: Callus, score: 53.386	N	N	N	N
vg0518335953	T -> C	LOC_Os05g31520.1	intron_variant ; MODIFIER	silent_mutation	Average:35.714; most accessible tissue: Callus, score: 53.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0518335953	NA	5.11E-19	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953	NA	4.25E-09	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953	NA	2.38E-06	mr1504	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953	NA	1.78E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953	NA	7.46E-15	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953	NA	8.22E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953	NA	1.04E-10	mr1134_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953	NA	4.86E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953	NA	1.71E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953	NA	1.42E-09	mr1504_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953	NA	1.08E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953	NA	3.16E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251