\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518335953:

Variant ID: vg0518335953 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18335953
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCATTACGCATTCCTCGAACAATGAAATTTGTGGAACATCAATAGCTTTACATGACAAGTAAAGATGAAGCGATTATTCAAAATAACACAAATTTTTT[T/C]
CACTTTCTAGTTTCCAGAGCATGAAAATAAAAGTGATGGCATAAAATCAGAACATAAGTAAAAAAAATCATTCAGAAAGTTAGATTGCTTGAAGAAGAGA

Reverse complement sequence

TCTCTTCTTCAAGCAATCTAACTTTCTGAATGATTTTTTTTACTTATGTTCTGATTTTATGCCATCACTTTTATTTTCATGCTCTGGAAACTAGAAAGTG[A/G]
AAAAAATTTGTGTTATTTTGAATAATCGCTTCATCTTTACTTGTCATGTAAAGCTATTGATGTTCCACAAATTTCATTGTTCGAGGAATGCGTAATGCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 36.20% 4.10% 3.85% NA
All Indica  2759 87.40% 6.60% 1.12% 4.82% NA
All Japonica  1512 4.70% 92.90% 0.00% 2.45% NA
Aus  269 39.80% 0.00% 57.62% 2.60% NA
Indica I  595 97.00% 2.50% 0.17% 0.34% NA
Indica II  465 48.20% 26.20% 2.80% 22.80% NA
Indica III  913 98.80% 0.80% 0.44% 0.00% NA
Indica Intermediate  786 90.20% 5.00% 1.65% 3.18% NA
Temperate Japonica  767 3.50% 95.60% 0.00% 0.91% NA
Tropical Japonica  504 7.50% 92.30% 0.00% 0.20% NA
Japonica Intermediate  241 2.50% 85.50% 0.00% 12.03% NA
VI/Aromatic  96 6.20% 88.50% 5.21% 0.00% NA
Intermediate  90 45.60% 45.60% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518335953 T -> DEL N N silent_mutation Average:35.714; most accessible tissue: Callus, score: 53.386 N N N N
vg0518335953 T -> C LOC_Os05g31525.1 upstream_gene_variant ; 4358.0bp to feature; MODIFIER silent_mutation Average:35.714; most accessible tissue: Callus, score: 53.386 N N N N
vg0518335953 T -> C LOC_Os05g31510.1 downstream_gene_variant ; 4275.0bp to feature; MODIFIER silent_mutation Average:35.714; most accessible tissue: Callus, score: 53.386 N N N N
vg0518335953 T -> C LOC_Os05g31520.1 intron_variant ; MODIFIER silent_mutation Average:35.714; most accessible tissue: Callus, score: 53.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518335953 NA 5.11E-19 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953 NA 4.25E-09 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953 NA 2.38E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953 NA 1.78E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953 NA 7.46E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953 NA 8.22E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953 NA 1.04E-10 mr1134_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953 NA 4.86E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953 NA 1.71E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953 NA 1.42E-09 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953 NA 1.08E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518335953 NA 3.16E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251