Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518324346:

Variant ID: vg0518324346 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18324346
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCTGTTCACTTTGATGAAAAAAAAAACTTACTAAATTTTGATATTACCAAAATTTTAGTATAGTTGTCAAAATTTTAACAATATTTCTTATATAGTTA[C/T]
CAAAATTTGGCAGCAAACTAAATGTAGCCACTGTTTTGGTAACTTTACTAAAAATTGGTAAGATTGCGCGGCTCGGAGATTCCGGTGCTCGTGCTGTGTC

Reverse complement sequence

GACACAGCACGAGCACCGGAATCTCCGAGCCGCGCAATCTTACCAATTTTTAGTAAAGTTACCAAAACAGTGGCTACATTTAGTTTGCTGCCAAATTTTG[G/A]
TAACTATATAAGAAATATTGTTAAAATTTTGACAACTATACTAAAATTTTGGTAATATCAAAATTTAGTAAGTTTTTTTTTTCATCAAAGTGAACAGGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 16.40% 0.57% 9.29% NA
All Indica  2759 88.70% 5.00% 0.33% 6.02% NA
All Japonica  1512 61.10% 35.50% 0.86% 2.51% NA
Aus  269 19.30% 0.00% 0.00% 80.67% NA
Indica I  595 99.00% 0.20% 0.67% 0.17% NA
Indica II  465 51.00% 22.20% 0.43% 26.45% NA
Indica III  913 99.10% 0.30% 0.00% 0.55% NA
Indica Intermediate  786 91.00% 3.90% 0.38% 4.71% NA
Temperate Japonica  767 95.60% 3.30% 0.26% 0.91% NA
Tropical Japonica  504 16.30% 82.10% 1.39% 0.20% NA
Japonica Intermediate  241 45.20% 40.70% 1.66% 12.45% NA
VI/Aromatic  96 8.30% 83.30% 1.04% 7.29% NA
Intermediate  90 60.00% 23.30% 4.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518324346 C -> T LOC_Os05g31490.1 upstream_gene_variant ; 370.0bp to feature; MODIFIER silent_mutation Average:96.841; most accessible tissue: Minghui63 young leaf, score: 98.671 N N N N
vg0518324346 C -> T LOC_Os05g31500.1 upstream_gene_variant ; 1608.0bp to feature; MODIFIER silent_mutation Average:96.841; most accessible tissue: Minghui63 young leaf, score: 98.671 N N N N
vg0518324346 C -> T LOC_Os05g31510.1 upstream_gene_variant ; 4423.0bp to feature; MODIFIER silent_mutation Average:96.841; most accessible tissue: Minghui63 young leaf, score: 98.671 N N N N
vg0518324346 C -> T LOC_Os05g31490-LOC_Os05g31500 intergenic_region ; MODIFIER silent_mutation Average:96.841; most accessible tissue: Minghui63 young leaf, score: 98.671 N N N N
vg0518324346 C -> DEL N N silent_mutation Average:96.841; most accessible tissue: Minghui63 young leaf, score: 98.671 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0518324346 C T -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518324346 NA 6.25E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 2.32E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 1.13E-06 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 1.75E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 1.13E-06 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 6.45E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 9.62E-06 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 5.11E-08 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 7.42E-06 7.10E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 4.21E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 1.11E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 6.00E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 5.44E-06 1.94E-10 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 4.62E-06 2.76E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 5.60E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 5.42E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 1.81E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 2.86E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 2.57E-06 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 1.18E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 2.33E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 2.03E-06 3.90E-10 mr1860_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518324346 NA 1.49E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251