\
| Variant ID: vg0518299665 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 18299665 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAGTGCAATCCTATCAATGCATAATATTTTGCAAGCAATATAATTAGATTTCAAATATAGGCTCAAGATGTTCAAAGGTGGCTTGCCTTGCTCGAGATCT[A/G,T]
GAGCTTGATCCTCGAAATCCTCGCACTGCGGGTCTTCGGGCTCCGAAACTACACGCGAAACGGGACAACTCAACAAACGGCGAAAATGAAACCCTAATAA
TTATTAGGGTTTCATTTTCGCCGTTTGTTGAGTTGTCCCGTTTCGCGTGTAGTTTCGGAGCCCGAAGACCCGCAGTGCGAGGATTTCGAGGATCAAGCTC[T/C,A]
AGATCTCGAGCAAGGCAAGCCACCTTTGAACATCTTGAGCCTATATTTGAAATCTAATTATATTGCTTGCAAAATATTATGCATTGATAGGATTGCACTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.90% | 1.30% | 14.68% | 44.05% | T: 0.11% |
| All Indica | 2759 | 11.10% | 1.70% | 24.07% | 62.96% | T: 0.18% |
| All Japonica | 1512 | 94.60% | 0.10% | 0.20% | 5.09% | NA |
| Aus | 269 | 4.80% | 4.10% | 7.81% | 83.27% | NA |
| Indica I | 595 | 6.90% | 2.70% | 22.52% | 67.73% | T: 0.17% |
| Indica II | 465 | 27.70% | 1.10% | 13.12% | 58.06% | NA |
| Indica III | 913 | 7.20% | 1.50% | 31.76% | 59.36% | T: 0.11% |
| Indica Intermediate | 786 | 8.90% | 1.50% | 22.77% | 66.41% | T: 0.38% |
| Temperate Japonica | 767 | 97.30% | 0.00% | 0.13% | 2.61% | NA |
| Tropical Japonica | 504 | 88.90% | 0.20% | 0.40% | 10.52% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 51.10% | 1.10% | 6.67% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0518299665 | A -> T | LOC_Os05g31460.1 | upstream_gene_variant ; 1138.0bp to feature; MODIFIER | silent_mutation | Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 | N | N | N | N |
| vg0518299665 | A -> T | LOC_Os05g31450-LOC_Os05g31460 | intergenic_region ; MODIFIER | silent_mutation | Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 | N | N | N | N |
| vg0518299665 | A -> G | LOC_Os05g31460.1 | upstream_gene_variant ; 1138.0bp to feature; MODIFIER | silent_mutation | Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 | N | N | N | N |
| vg0518299665 | A -> G | LOC_Os05g31450-LOC_Os05g31460 | intergenic_region ; MODIFIER | silent_mutation | Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 | N | N | N | N |
| vg0518299665 | A -> DEL | N | N | silent_mutation | Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0518299665 | 4.68E-06 | 1.42E-06 | mr1036 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518299665 | 5.15E-06 | 1.97E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518299665 | 4.46E-06 | 4.46E-06 | mr1331 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518299665 | 8.16E-06 | 8.16E-06 | mr1384 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518299665 | NA | 2.50E-06 | mr1439 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518299665 | NA | 6.09E-06 | mr1968 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |