Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518299665:

Variant ID: vg0518299665 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 18299665
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGTGCAATCCTATCAATGCATAATATTTTGCAAGCAATATAATTAGATTTCAAATATAGGCTCAAGATGTTCAAAGGTGGCTTGCCTTGCTCGAGATCT[A/G,T]
GAGCTTGATCCTCGAAATCCTCGCACTGCGGGTCTTCGGGCTCCGAAACTACACGCGAAACGGGACAACTCAACAAACGGCGAAAATGAAACCCTAATAA

Reverse complement sequence

TTATTAGGGTTTCATTTTCGCCGTTTGTTGAGTTGTCCCGTTTCGCGTGTAGTTTCGGAGCCCGAAGACCCGCAGTGCGAGGATTTCGAGGATCAAGCTC[T/C,A]
AGATCTCGAGCAAGGCAAGCCACCTTTGAACATCTTGAGCCTATATTTGAAATCTAATTATATTGCTTGCAAAATATTATGCATTGATAGGATTGCACTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.90%	1.30%	14.68%	44.05%	T: 0.11%
All Indica	2759	11.10%	1.70%	24.07%	62.96%	T: 0.18%
All Japonica	1512	94.60%	0.10%	0.20%	5.09%	NA
Aus	269	4.80%	4.10%	7.81%	83.27%	NA
Indica I	595	6.90%	2.70%	22.52%	67.73%	T: 0.17%
Indica II	465	27.70%	1.10%	13.12%	58.06%	NA
Indica III	913	7.20%	1.50%	31.76%	59.36%	T: 0.11%
Indica Intermediate	786	8.90%	1.50%	22.77%	66.41%	T: 0.38%
Temperate Japonica	767	97.30%	0.00%	0.13%	2.61%	NA
Tropical Japonica	504	88.90%	0.20%	0.40%	10.52%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	92.70%	0.00%	0.00%	7.29%	NA
Intermediate	90	51.10%	1.10%	6.67%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0518299665	A -> T	LOC_Os05g31460.1	upstream_gene_variant ; 1138.0bp to feature; MODIFIER	silent_mutation	Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605	N	N	N	N
vg0518299665	A -> T	LOC_Os05g31450-LOC_Os05g31460	intergenic_region ; MODIFIER	silent_mutation	Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605	N	N	N	N
vg0518299665	A -> G	LOC_Os05g31460.1	upstream_gene_variant ; 1138.0bp to feature; MODIFIER	silent_mutation	Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605	N	N	N	N
vg0518299665	A -> G	LOC_Os05g31450-LOC_Os05g31460	intergenic_region ; MODIFIER	silent_mutation	Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605	N	N	N	N
vg0518299665	A -> DEL	N	N	silent_mutation	Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0518299665	4.68E-06	1.42E-06	mr1036	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518299665	5.15E-06	1.97E-06	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518299665	4.46E-06	4.46E-06	mr1331	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518299665	8.16E-06	8.16E-06	mr1384	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518299665	NA	2.50E-06	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518299665	NA	6.09E-06	mr1968	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251