\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518299665:

Variant ID: vg0518299665 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18299665
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTGCAATCCTATCAATGCATAATATTTTGCAAGCAATATAATTAGATTTCAAATATAGGCTCAAGATGTTCAAAGGTGGCTTGCCTTGCTCGAGATCT[A/G,T]
GAGCTTGATCCTCGAAATCCTCGCACTGCGGGTCTTCGGGCTCCGAAACTACACGCGAAACGGGACAACTCAACAAACGGCGAAAATGAAACCCTAATAA

Reverse complement sequence

TTATTAGGGTTTCATTTTCGCCGTTTGTTGAGTTGTCCCGTTTCGCGTGTAGTTTCGGAGCCCGAAGACCCGCAGTGCGAGGATTTCGAGGATCAAGCTC[T/C,A]
AGATCTCGAGCAAGGCAAGCCACCTTTGAACATCTTGAGCCTATATTTGAAATCTAATTATATTGCTTGCAAAATATTATGCATTGATAGGATTGCACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.90% 1.30% 14.68% 44.05% T: 0.11%
All Indica  2759 11.10% 1.70% 24.07% 62.96% T: 0.18%
All Japonica  1512 94.60% 0.10% 0.20% 5.09% NA
Aus  269 4.80% 4.10% 7.81% 83.27% NA
Indica I  595 6.90% 2.70% 22.52% 67.73% T: 0.17%
Indica II  465 27.70% 1.10% 13.12% 58.06% NA
Indica III  913 7.20% 1.50% 31.76% 59.36% T: 0.11%
Indica Intermediate  786 8.90% 1.50% 22.77% 66.41% T: 0.38%
Temperate Japonica  767 97.30% 0.00% 0.13% 2.61% NA
Tropical Japonica  504 88.90% 0.20% 0.40% 10.52% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 51.10% 1.10% 6.67% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518299665 A -> T LOC_Os05g31460.1 upstream_gene_variant ; 1138.0bp to feature; MODIFIER silent_mutation Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 N N N N
vg0518299665 A -> T LOC_Os05g31450-LOC_Os05g31460 intergenic_region ; MODIFIER silent_mutation Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 N N N N
vg0518299665 A -> G LOC_Os05g31460.1 upstream_gene_variant ; 1138.0bp to feature; MODIFIER silent_mutation Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 N N N N
vg0518299665 A -> G LOC_Os05g31450-LOC_Os05g31460 intergenic_region ; MODIFIER silent_mutation Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 N N N N
vg0518299665 A -> DEL N N silent_mutation Average:7.013; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518299665 4.68E-06 1.42E-06 mr1036 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518299665 5.15E-06 1.97E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518299665 4.46E-06 4.46E-06 mr1331 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518299665 8.16E-06 8.16E-06 mr1384 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518299665 NA 2.50E-06 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518299665 NA 6.09E-06 mr1968 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251