Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518099801:

Variant ID: vg0518099801 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18099801
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGCCGACCGGCCCTCGCTGGAGGGAACGGTGGGGCTCGGCCTATCGCCGGTGGCCTTTCCTTTGCGCGGGGCCCGCGTGGGCCCGTCTGCTGCAAGGA[C/T]
ATGGCCCTCGTCATCGGAGCGGGCTGGTTTCCTTTTGCCTCTCCTATCTCGCCGCTTAGAGCGGGGGGCAGATTCGGGGGTAGCCGCAGCCGCCGCACCG

Reverse complement sequence

CGGTGCGGCGGCTGCGGCTACCCCCGAATCTGCCCCCCGCTCTAAGCGGCGAGATAGGAGAGGCAAAAGGAAACCAGCCCGCTCCGATGACGAGGGCCAT[G/A]
TCCTTGCAGCAGACGGGCCCACGCGGGCCCCGCGCAAAGGAAAGGCCACCGGCGATAGGCCGAGCCCCACCGTTCCCTCCAGCGAGGGCCGGTCGGCGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.80% 21.80% 0.38% 0.00% NA
All Indica  2759 92.80% 7.00% 0.29% 0.00% NA
All Japonica  1512 51.50% 47.90% 0.66% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 75.10% 24.10% 0.86% 0.00% NA
Indica III  913 96.90% 3.00% 0.11% 0.00% NA
Indica Intermediate  786 92.90% 6.70% 0.38% 0.00% NA
Temperate Japonica  767 79.30% 20.50% 0.26% 0.00% NA
Tropical Japonica  504 21.00% 77.80% 1.19% 0.00% NA
Japonica Intermediate  241 26.60% 72.60% 0.83% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518099801 C -> T LOC_Os05g31130.1 missense_variant ; p.Val420Ile; MODERATE nonsynonymous_codon ; V420I Average:72.6; most accessible tissue: Minghui63 flag leaf, score: 87.461 benign 0.877 DELETERIOUS 0.02

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0518099801 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518099801 2.32E-06 4.50E-09 mr1415 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518099801 NA 7.30E-06 mr1564 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518099801 2.32E-06 4.50E-09 mr1567 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518099801 NA 2.95E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518099801 NA 5.86E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518099801 9.19E-06 NA mr1758_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518099801 NA 5.85E-06 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251