\
| Variant ID: vg0518072547 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 18072547 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, G: 0.10, others allele: 0.00, population size: 103. )
TGATATATCCAGTCCATAGCCAATTTGGTCTAACTCCATCGGCTGTGACCATCAACGATACACTATCGGCCTATCGGCCGATCAGCTATCGGTTGACTGA[T/G]
TCTGCTTTTATTCTTTCTTGCTGATTGCAGGATCAAATCAACTGACACGCCCTTGACACACTCGAGGCTAGCCTTGGACCTGCACTGGAGTTAAGCAGAT
ATCTGCTTAACTCCAGTGCAGGTCCAAGGCTAGCCTCGAGTGTGTCAAGGGCGTGTCAGTTGATTTGATCCTGCAATCAGCAAGAAAGAATAAAAGCAGA[A/C]
TCAGTCAACCGATAGCTGATCGGCCGATAGGCCGATAGTGTATCGTTGATGGTCACAGCCGATGGAGTTAGACCAAATTGGCTATGGACTGGATATATCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 41.50% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 90.30% | 9.30% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 8.00% | 91.50% | 0.46% | 0.00% | NA |
| Aus | 269 | 32.30% | 67.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 71.80% | 27.30% | 0.86% | 0.00% | NA |
| Indica III | 913 | 93.60% | 6.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 90.70% | 9.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 2.50% | 97.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 19.40% | 80.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 53.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0518072547 | T -> G | LOC_Os05g31090.1 | downstream_gene_variant ; 3293.0bp to feature; MODIFIER | silent_mutation | Average:54.509; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0518072547 | T -> G | LOC_Os05g31100.1 | downstream_gene_variant ; 753.0bp to feature; MODIFIER | silent_mutation | Average:54.509; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0518072547 | T -> G | LOC_Os05g31110.1 | downstream_gene_variant ; 2754.0bp to feature; MODIFIER | silent_mutation | Average:54.509; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0518072547 | T -> G | LOC_Os05g31090-LOC_Os05g31100 | intergenic_region ; MODIFIER | silent_mutation | Average:54.509; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0518072547 | NA | 7.08E-08 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | NA | 1.77E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | NA | 1.56E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | NA | 7.59E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | NA | 1.53E-20 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | NA | 4.64E-07 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | NA | 7.00E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | NA | 4.60E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | NA | 2.45E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | NA | 5.07E-06 | mr1482 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | NA | 7.51E-06 | mr1564 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | 3.59E-07 | 1.98E-13 | mr1827 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0518072547 | NA | 3.92E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |