\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0518072547:

Variant ID: vg0518072547 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 18072547
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, G: 0.10, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TGATATATCCAGTCCATAGCCAATTTGGTCTAACTCCATCGGCTGTGACCATCAACGATACACTATCGGCCTATCGGCCGATCAGCTATCGGTTGACTGA[T/G]
TCTGCTTTTATTCTTTCTTGCTGATTGCAGGATCAAATCAACTGACACGCCCTTGACACACTCGAGGCTAGCCTTGGACCTGCACTGGAGTTAAGCAGAT

Reverse complement sequence

ATCTGCTTAACTCCAGTGCAGGTCCAAGGCTAGCCTCGAGTGTGTCAAGGGCGTGTCAGTTGATTTGATCCTGCAATCAGCAAGAAAGAATAAAAGCAGA[A/C]
TCAGTCAACCGATAGCTGATCGGCCGATAGGCCGATAGTGTATCGTTGATGGTCACAGCCGATGGAGTTAGACCAAATTGGCTATGGACTGGATATATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.50% 0.42% 0.00% NA
All Indica  2759 90.30% 9.30% 0.36% 0.00% NA
All Japonica  1512 8.00% 91.50% 0.46% 0.00% NA
Aus  269 32.30% 67.30% 0.37% 0.00% NA
Indica I  595 99.20% 0.30% 0.50% 0.00% NA
Indica II  465 71.80% 27.30% 0.86% 0.00% NA
Indica III  913 93.60% 6.10% 0.22% 0.00% NA
Indica Intermediate  786 90.70% 9.20% 0.13% 0.00% NA
Temperate Japonica  767 2.50% 97.40% 0.13% 0.00% NA
Tropical Japonica  504 19.40% 80.00% 0.60% 0.00% NA
Japonica Intermediate  241 1.70% 97.10% 1.24% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 44.40% 53.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0518072547 T -> G LOC_Os05g31090.1 downstream_gene_variant ; 3293.0bp to feature; MODIFIER silent_mutation Average:54.509; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0518072547 T -> G LOC_Os05g31100.1 downstream_gene_variant ; 753.0bp to feature; MODIFIER silent_mutation Average:54.509; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0518072547 T -> G LOC_Os05g31110.1 downstream_gene_variant ; 2754.0bp to feature; MODIFIER silent_mutation Average:54.509; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0518072547 T -> G LOC_Os05g31090-LOC_Os05g31100 intergenic_region ; MODIFIER silent_mutation Average:54.509; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0518072547 NA 7.08E-08 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 NA 1.77E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 NA 1.56E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 NA 7.59E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 NA 1.53E-20 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 NA 4.64E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 NA 7.00E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 NA 4.60E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 NA 2.45E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 NA 5.07E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 NA 7.51E-06 mr1564 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 3.59E-07 1.98E-13 mr1827 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0518072547 NA 3.92E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251