Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517992463:

Variant ID: vg0517992463 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17992463
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.08, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TCCATCTCAAATCTTTAGACTTTGGCATGATCTTCTTTAACCAATTATATTCATAAAAATAAGTTGTTATAAACAAAAAAAGGGTTACATATTAATAGTT[C/T]
GTCTAATGATAAATCTAATAACATCATTCATATGTGATCAATCTTGTTTATTCTTTCGTTATTAATAGTTAAATTAAAAATATCTGACTTAGCATTATTC

Reverse complement sequence

GAATAATGCTAAGTCAGATATTTTTAATTTAACTATTAATAACGAAAGAATAAACAAGATTGATCACATATGAATGATGTTATTAGATTTATCATTAGAC[G/A]
AACTATTAATATGTAACCCTTTTTTTGTTTATAACAACTTATTTTTATGAATATAATTGGTTAAAGAAGATCATGCCAAAGTCTAAAGATTTGAGATGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 16.80% 0.11% 0.00% NA
All Indica  2759 95.10% 4.90% 0.07% 0.00% NA
All Japonica  1512 57.50% 42.30% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 76.80% 22.80% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.60% 0.00% 0.00% NA
Temperate Japonica  767 79.00% 20.90% 0.13% 0.00% NA
Tropical Japonica  504 38.30% 61.50% 0.20% 0.00% NA
Japonica Intermediate  241 29.00% 70.50% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517992463 C -> T LOC_Os05g30980.1 upstream_gene_variant ; 2740.0bp to feature; MODIFIER silent_mutation Average:78.453; most accessible tissue: Callus, score: 90.185 N N N N
vg0517992463 C -> T LOC_Os05g30980.2 upstream_gene_variant ; 3194.0bp to feature; MODIFIER silent_mutation Average:78.453; most accessible tissue: Callus, score: 90.185 N N N N
vg0517992463 C -> T LOC_Os05g30970.1 downstream_gene_variant ; 2552.0bp to feature; MODIFIER silent_mutation Average:78.453; most accessible tissue: Callus, score: 90.185 N N N N
vg0517992463 C -> T LOC_Os05g30970-LOC_Os05g30980 intergenic_region ; MODIFIER silent_mutation Average:78.453; most accessible tissue: Callus, score: 90.185 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0517992463 C T 0.0 0.0 0.0 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517992463 NA 3.90E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517992463 2.18E-06 NA mr1136 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517992463 NA 8.82E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517992463 NA 1.30E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251