Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517990921:

Variant ID: vg0517990921 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17990921
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTCTTCAAACTTCCAACTTTTCTATCACATCAAAACTTTTTTAAACACACAAGCTTCCAACTTTTCCGTCACATTATTCCAATTTCAACCAAACTTT[C/T]
AATTTTGGCGTGAACTAAACACACCCATAGAAGGAAATTACTGATTTACTCGAAGAAGGTAACCATGCATGAAAATTCAACGATGTCTTTATCAAAGATT

Reverse complement sequence

AATCTTTGATAAAGACATCGTTGAATTTTCATGCATGGTTACCTTCTTCGAGTAAATCAGTAATTTCCTTCTATGGGTGTGTTTAGTTCACGCCAAAATT[G/A]
AAAGTTTGGTTGAAATTGGAATAATGTGACGGAAAAGTTGGAAGCTTGTGTGTTTAAAAAAGTTTTGATGTGATAGAAAAGTTGGAAGTTTGAAGAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.10%	6.80%	0.15%	15.95%	NA
All Indica	2759	93.10%	2.30%	0.11%	4.53%	NA
All Japonica	1512	48.90%	10.60%	0.20%	40.34%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	76.80%	1.70%	0.43%	21.08%	NA
Indica III	913	96.70%	3.30%	0.00%	0.00%	NA
Indica Intermediate	786	93.30%	3.20%	0.13%	3.44%	NA
Temperate Japonica	767	72.10%	8.20%	0.00%	19.69%	NA
Tropical Japonica	504	24.00%	17.10%	0.40%	58.53%	NA
Japonica Intermediate	241	27.00%	4.60%	0.41%	68.05%	NA
VI/Aromatic	96	8.30%	87.50%	0.00%	4.17%	NA
Intermediate	90	66.70%	15.60%	1.11%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517990921	C -> T	LOC_Os05g30980.1	upstream_gene_variant ; 4282.0bp to feature; MODIFIER	silent_mutation	Average:71.242; most accessible tissue: Zhenshan97 root, score: 88.924	N	N	N	N
vg0517990921	C -> T	LOC_Os05g30980.2	upstream_gene_variant ; 4736.0bp to feature; MODIFIER	silent_mutation	Average:71.242; most accessible tissue: Zhenshan97 root, score: 88.924	N	N	N	N
vg0517990921	C -> T	LOC_Os05g30970.1	downstream_gene_variant ; 1010.0bp to feature; MODIFIER	silent_mutation	Average:71.242; most accessible tissue: Zhenshan97 root, score: 88.924	N	N	N	N
vg0517990921	C -> T	LOC_Os05g30970-LOC_Os05g30980	intergenic_region ; MODIFIER	silent_mutation	Average:71.242; most accessible tissue: Zhenshan97 root, score: 88.924	N	N	N	N
vg0517990921	C -> DEL	N	N	silent_mutation	Average:71.242; most accessible tissue: Zhenshan97 root, score: 88.924	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517990921	NA	1.71E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	NA	6.34E-08	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	NA	7.00E-07	mr1038_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	NA	2.95E-10	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	NA	1.88E-07	mr1169_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	NA	8.09E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	NA	3.06E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	1.72E-06	NA	mr1758_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	NA	2.09E-14	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	NA	4.75E-06	mr1831_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	5.79E-08	NA	mr1838_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	1.34E-06	4.79E-07	mr1838_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	NA	7.02E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	2.71E-08	1.23E-23	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	NA	3.58E-06	mr1842_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517990921	NA	2.37E-14	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251