\
| Variant ID: vg0517984725 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17984725 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, G: 0.34, others allele: 0.00, population size: 80. )
TCTTCATAAGATTTATTCAACACCGTCTAAAAATAAAATATAGTTATAATATTATAATCTGTCTTTTATTCTGAAAAATATATGCAAGGAAATAAGGAAT[G/T]
GAGATATGCCTATTTGAAGAGTTGTAGGTTCACACCTTTTCTCTTTATAAATTGCCACTCCACTCATGCATTTTCCCCTTACAATTTTAGGCTCATATCC
GGATATGAGCCTAAAATTGTAAGGGGAAAATGCATGAGTGGAGTGGCAATTTATAAAGAGAAAAGGTGTGAACCTACAACTCTTCAAATAGGCATATCTC[C/A]
ATTCCTTATTTCCTTGCATATATTTTTCAGAATAAAAGACAGATTATAATATTATAACTATATTTTATTTTTAGACGGTGTTGAATAAATCTTATGAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.00% | 16.90% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 95.00% | 4.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 57.40% | 42.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 76.30% | 23.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 79.00% | 20.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 38.10% | 61.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.00% | 71.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517984725 | G -> T | LOC_Os05g30970.1 | intron_variant ; MODIFIER | silent_mutation | Average:58.232; most accessible tissue: Callus, score: 84.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517984725 | NA | 9.64E-06 | mr1002 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | NA | 2.09E-07 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | NA | 7.54E-07 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | 3.02E-06 | 3.02E-06 | mr1406 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | NA | 3.03E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | NA | 5.16E-06 | mr1482 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | NA | 2.63E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | NA | 1.74E-07 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | NA | 3.65E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | NA | 5.37E-07 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | NA | 4.44E-06 | mr1399_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | NA | 5.08E-07 | mr1544_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517984725 | NA | 2.64E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |