Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517981962:

Variant ID: vg0517981962 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17981962
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TGATTGATTAAAATTACTAGGGTGAGACATTTTTTTTCATATTTCAGACCAAAATAAGAAGATGAAAACTCTTCATTTTAACCTATAAACTCCATTTATC[C/T]
TTTTCTTTTCTATAAGTTCGATTTTGAGTGCTAAAGCTGATGGGGGTGAACCAGAGCAACAAGAGAAAATAAAAGTTTGTACAGTGAGATAACTGCTACT

Reverse complement sequence

AGTAGCAGTTATCTCACTGTACAAACTTTTATTTTCTCTTGTTGCTCTGGTTCACCCCCATCAGCTTTAGCACTCAAAATCGAACTTATAGAAAAGAAAA[G/A]
GATAAATGGAGTTTATAGGTTAAAATGAAGAGTTTTCATCTTCTTATTTTGGTCTGAAATATGAAAAAAAATGTCTCACCCTAGTAATTTTAATCAATCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.10%	26.00%	0.59%	16.38%	NA
All Indica	2759	88.80%	5.60%	0.87%	4.71%	NA
All Japonica	1512	9.50%	48.90%	0.13%	41.53%	NA
Aus	269	23.00%	77.00%	0.00%	0.00%	NA
Indica I	595	83.90%	13.60%	2.52%	0.00%	NA
Indica II	465	75.10%	1.90%	0.65%	22.37%	NA
Indica III	913	95.20%	4.80%	0.00%	0.00%	NA
Indica Intermediate	786	93.40%	2.50%	0.76%	3.31%	NA
Temperate Japonica	767	3.70%	75.90%	0.13%	20.34%	NA
Tropical Japonica	504	20.60%	18.80%	0.00%	60.52%	NA
Japonica Intermediate	241	4.60%	25.70%	0.41%	69.29%	NA
VI/Aromatic	96	0.00%	99.00%	1.04%	0.00%	NA
Intermediate	90	45.60%	35.60%	1.11%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517981962	C -> T	LOC_Os05g30970.1	upstream_gene_variant ; 1320.0bp to feature; MODIFIER	silent_mutation	Average:45.449; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0517981962	C -> T	LOC_Os05g30960.1	downstream_gene_variant ; 3345.0bp to feature; MODIFIER	silent_mutation	Average:45.449; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0517981962	C -> T	LOC_Os05g30960-LOC_Os05g30970	intergenic_region ; MODIFIER	silent_mutation	Average:45.449; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0517981962	C -> DEL	N	N	silent_mutation	Average:45.449; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517981962	NA	6.52E-18	mr1013	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	3.12E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	3.11E-13	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	1.10E-14	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	4.35E-17	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	2.02E-08	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	1.76E-14	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	6.78E-09	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	9.86E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	7.25E-07	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	6.28E-07	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	2.45E-06	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	1.59E-07	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	2.23E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	2.30E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	5.57E-10	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	3.00E-09	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	2.37E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962	NA	4.09E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251