\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517981962:

Variant ID: vg0517981962 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17981962
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TGATTGATTAAAATTACTAGGGTGAGACATTTTTTTTCATATTTCAGACCAAAATAAGAAGATGAAAACTCTTCATTTTAACCTATAAACTCCATTTATC[C/T]
TTTTCTTTTCTATAAGTTCGATTTTGAGTGCTAAAGCTGATGGGGGTGAACCAGAGCAACAAGAGAAAATAAAAGTTTGTACAGTGAGATAACTGCTACT

Reverse complement sequence

AGTAGCAGTTATCTCACTGTACAAACTTTTATTTTCTCTTGTTGCTCTGGTTCACCCCCATCAGCTTTAGCACTCAAAATCGAACTTATAGAAAAGAAAA[G/A]
GATAAATGGAGTTTATAGGTTAAAATGAAGAGTTTTCATCTTCTTATTTTGGTCTGAAATATGAAAAAAAATGTCTCACCCTAGTAATTTTAATCAATCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 26.00% 0.59% 16.38% NA
All Indica  2759 88.80% 5.60% 0.87% 4.71% NA
All Japonica  1512 9.50% 48.90% 0.13% 41.53% NA
Aus  269 23.00% 77.00% 0.00% 0.00% NA
Indica I  595 83.90% 13.60% 2.52% 0.00% NA
Indica II  465 75.10% 1.90% 0.65% 22.37% NA
Indica III  913 95.20% 4.80% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 2.50% 0.76% 3.31% NA
Temperate Japonica  767 3.70% 75.90% 0.13% 20.34% NA
Tropical Japonica  504 20.60% 18.80% 0.00% 60.52% NA
Japonica Intermediate  241 4.60% 25.70% 0.41% 69.29% NA
VI/Aromatic  96 0.00% 99.00% 1.04% 0.00% NA
Intermediate  90 45.60% 35.60% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517981962 C -> T LOC_Os05g30970.1 upstream_gene_variant ; 1320.0bp to feature; MODIFIER silent_mutation Average:45.449; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0517981962 C -> T LOC_Os05g30960.1 downstream_gene_variant ; 3345.0bp to feature; MODIFIER silent_mutation Average:45.449; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0517981962 C -> T LOC_Os05g30960-LOC_Os05g30970 intergenic_region ; MODIFIER silent_mutation Average:45.449; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0517981962 C -> DEL N N silent_mutation Average:45.449; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517981962 NA 6.52E-18 mr1013 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 3.12E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 3.11E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 1.10E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 4.35E-17 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 2.02E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 1.76E-14 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 6.78E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 9.86E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 7.25E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 6.28E-07 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 2.45E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 1.59E-07 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 2.23E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 2.30E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 5.57E-10 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 3.00E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 2.37E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981962 NA 4.09E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251