Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517981167:

Variant ID: vg0517981167 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17981167
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATGGATACGATCCCCTCTATTTTGTATTTATACCCACAGATGTCCCCTTGTCCAAGTAGAACTAGTAGATGTCCCCTCTGTTTTGTATTTATACCAA[C/T]
AGATGTCCTCTTGTCCAAGTAAAATTAGGAAGACAAATATGGCGATCCCCTTTAGTTTGTATTTATACCCACAGATGTCCCCTTGTTAAGTAGAACTAGC

Reverse complement sequence

GCTAGTTCTACTTAACAAGGGGACATCTGTGGGTATAAATACAAACTAAAGGGGATCGCCATATTTGTCTTCCTAATTTTACTTGGACAAGAGGACATCT[G/A]
TTGGTATAAATACAAAACAGAGGGGACATCTACTAGTTCTACTTGGACAAGGGGACATCTGTGGGTATAAATACAAAATAGAGGGGATCGTATCCATATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.40%	18.30%	0.17%	16.19%	NA
All Indica	2759	94.80%	0.70%	0.14%	4.42%	NA
All Japonica	1512	9.70%	48.70%	0.13%	41.53%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	76.60%	1.30%	0.43%	21.72%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	96.30%	0.80%	0.25%	2.67%	NA
Temperate Japonica	767	3.70%	76.00%	0.00%	20.34%	NA
Tropical Japonica	504	20.80%	18.30%	0.00%	60.91%	NA
Japonica Intermediate	241	5.40%	25.30%	0.83%	68.46%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	56.70%	24.40%	2.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517981167	C -> T	LOC_Os05g30970.1	upstream_gene_variant ; 2115.0bp to feature; MODIFIER	silent_mutation	Average:50.315; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0517981167	C -> T	LOC_Os05g30960.1	downstream_gene_variant ; 2550.0bp to feature; MODIFIER	silent_mutation	Average:50.315; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0517981167	C -> T	LOC_Os05g30960-LOC_Os05g30970	intergenic_region ; MODIFIER	silent_mutation	Average:50.315; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0517981167	C -> DEL	N	N	silent_mutation	Average:50.315; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517981167	NA	9.27E-08	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	5.22E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	2.13E-11	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	1.18E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	3.61E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	2.13E-07	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	1.83E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	5.15E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	7.23E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	6.18E-06	NA	mr1544_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	2.11E-07	mr1544_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	7.17E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	5.08E-09	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	1.89E-08	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	1.01E-08	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	2.58E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	7.76E-06	mr1747_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	3.51E-09	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	1.27E-09	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	9.39E-07	mr1831_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	2.34E-08	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	3.18E-16	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	2.66E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	1.97E-18	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	6.05E-10	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	9.08E-10	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	1.02E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517981167	NA	1.74E-06	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251