\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517977400:

Variant ID: vg0517977400 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17977400
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, C: 0.34, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTAACTTTTTTTTAAATTTTTTTTTATGGTGTACTATATTAGGAAGAGAAGAAGGGGGAAGGAAGGGGGGAGAGGAGGGAGGAGTGTATAGAGTATA[G/C]
GGGAGGGGGCGGATCTAATCGCTTGGGCGATAGACTAGTGATCGATCGCCCATTAGCCCCCCCACATCGTTTGCGCCGTTTGAGAAATTTTTTTAAGGGA

Reverse complement sequence

TCCCTTAAAAAAATTTCTCAAACGGCGCAAACGATGTGGGGGGGCTAATGGGCGATCGATCACTAGTCTATCGCCCAAGCGATTAGATCCGCCCCCTCCC[C/G]
TATACTCTATACACTCCTCCCTCCTCTCCCCCCTTCCTTCCCCCTTCTTCTCTTCCTAATATAGTACACCATAAAAAAAAATTTAAAAAAAAGTTAGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.60% 18.10% 12.48% 24.84% NA
All Indica  2759 62.00% 0.80% 19.43% 17.80% NA
All Japonica  1512 6.30% 48.30% 2.25% 43.12% NA
Aus  269 95.20% 0.00% 2.23% 2.60% NA
Indica I  595 57.80% 0.50% 30.92% 10.76% NA
Indica II  465 48.60% 1.30% 15.70% 34.41% NA
Indica III  913 69.90% 0.80% 13.80% 15.55% NA
Indica Intermediate  786 63.90% 0.80% 19.47% 15.90% NA
Temperate Japonica  767 2.10% 76.00% 0.91% 20.99% NA
Tropical Japonica  504 13.30% 17.50% 4.96% 64.29% NA
Japonica Intermediate  241 5.00% 24.90% 0.83% 69.29% NA
VI/Aromatic  96 11.50% 87.50% 1.04% 0.00% NA
Intermediate  90 37.80% 21.10% 14.44% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517977400 G -> DEL N N silent_mutation Average:53.306; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N
vg0517977400 G -> C LOC_Os05g30960.1 upstream_gene_variant ; 750.0bp to feature; MODIFIER silent_mutation Average:53.306; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N
vg0517977400 G -> C LOC_Os05g30950-LOC_Os05g30960 intergenic_region ; MODIFIER silent_mutation Average:53.306; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517977400 NA 1.42E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 3.01E-17 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 1.39E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 3.40E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 1.18E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 8.40E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 7.43E-10 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 8.78E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 5.41E-06 5.41E-06 mr1497_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 3.54E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 7.63E-06 mr1577_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 1.01E-07 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 9.92E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 1.82E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 5.46E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 1.45E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 2.38E-10 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 4.09E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 9.69E-06 NA mr1794_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 1.85E-10 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 1.56E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 6.92E-08 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 6.20E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 5.91E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 3.75E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 2.22E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 7.98E-17 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 8.74E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 6.43E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 1.23E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517977400 NA 1.24E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251