\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517961716:

Variant ID: vg0517961716 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17961716
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTTATTTTTTGTGTGTAACTGAAATGTAGGTCCCACGTGTGTTATTATTTTTCGTAATCAAGTTACCACGTAAGTGTCATGTCAATGCCACGTGG[G/A]
ACGAAGACCTAGTCAAATGAGCCACATAGGCTAAAACTATGGTCAATACTATCGAGGGACCTTGTTTGTATGGTTTTATAAGTTAGGGATGCGTCATATC

Reverse complement sequence

GATATGACGCATCCCTAACTTATAAAACCATACAAACAAGGTCCCTCGATAGTATTGACCATAGTTTTAGCCTATGTGGCTCATTTGACTAGGTCTTCGT[C/T]
CCACGTGGCATTGACATGACACTTACGTGGTAACTTGATTACGAAAAATAATAACACACGTGGGACCTACATTTCAGTTACACACAAAAAATAAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 16.60% 0.13% 0.19% NA
All Indica  2759 95.00% 4.80% 0.07% 0.11% NA
All Japonica  1512 57.40% 42.10% 0.20% 0.33% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 76.30% 22.80% 0.22% 0.65% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.40% 0.13% 0.00% NA
Temperate Japonica  767 79.30% 20.50% 0.00% 0.26% NA
Tropical Japonica  504 37.70% 61.50% 0.40% 0.40% NA
Japonica Intermediate  241 29.00% 70.10% 0.41% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 18.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517961716 G -> DEL N N silent_mutation Average:78.73; most accessible tissue: Callus, score: 85.695 N N N N
vg0517961716 G -> A LOC_Os05g30930.1 downstream_gene_variant ; 125.0bp to feature; MODIFIER silent_mutation Average:78.73; most accessible tissue: Callus, score: 85.695 N N N N
vg0517961716 G -> A LOC_Os05g30940.1 downstream_gene_variant ; 318.0bp to feature; MODIFIER silent_mutation Average:78.73; most accessible tissue: Callus, score: 85.695 N N N N
vg0517961716 G -> A LOC_Os05g30950.1 downstream_gene_variant ; 3345.0bp to feature; MODIFIER silent_mutation Average:78.73; most accessible tissue: Callus, score: 85.695 N N N N
vg0517961716 G -> A LOC_Os05g30950.3 downstream_gene_variant ; 3345.0bp to feature; MODIFIER silent_mutation Average:78.73; most accessible tissue: Callus, score: 85.695 N N N N
vg0517961716 G -> A LOC_Os05g30930-LOC_Os05g30940 intergenic_region ; MODIFIER silent_mutation Average:78.73; most accessible tissue: Callus, score: 85.695 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517961716 NA 7.67E-06 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 3.66E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 2.91E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 1.53E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 7.82E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 5.65E-07 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 3.06E-08 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 1.35E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 1.53E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 1.27E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 1.06E-06 mr1399_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 9.28E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 2.11E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 1.49E-06 8.29E-09 mr1544_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 5.06E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 6.69E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716 NA 6.76E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251