Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517961716:

Variant ID: vg0517961716 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17961716
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTTTATTTTTTGTGTGTAACTGAAATGTAGGTCCCACGTGTGTTATTATTTTTCGTAATCAAGTTACCACGTAAGTGTCATGTCAATGCCACGTGG[G/A]
ACGAAGACCTAGTCAAATGAGCCACATAGGCTAAAACTATGGTCAATACTATCGAGGGACCTTGTTTGTATGGTTTTATAAGTTAGGGATGCGTCATATC

Reverse complement sequence

GATATGACGCATCCCTAACTTATAAAACCATACAAACAAGGTCCCTCGATAGTATTGACCATAGTTTTAGCCTATGTGGCTCATTTGACTAGGTCTTCGT[C/T]
CCACGTGGCATTGACATGACACTTACGTGGTAACTTGATTACGAAAAATAATAACACACGTGGGACCTACATTTCAGTTACACACAAAAAATAAAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.10%	16.60%	0.13%	0.19%	NA
All Indica	2759	95.00%	4.80%	0.07%	0.11%	NA
All Japonica	1512	57.40%	42.10%	0.20%	0.33%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	76.30%	22.80%	0.22%	0.65%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.40%	3.40%	0.13%	0.00%	NA
Temperate Japonica	767	79.30%	20.50%	0.00%	0.26%	NA
Tropical Japonica	504	37.70%	61.50%	0.40%	0.40%	NA
Japonica Intermediate	241	29.00%	70.10%	0.41%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	18.90%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517961716	G -> DEL	N	N	silent_mutation	Average:78.73; most accessible tissue: Callus, score: 85.695	N	N	N	N
vg0517961716	G -> A	LOC_Os05g30930.1	downstream_gene_variant ; 125.0bp to feature; MODIFIER	silent_mutation	Average:78.73; most accessible tissue: Callus, score: 85.695	N	N	N	N
vg0517961716	G -> A	LOC_Os05g30940.1	downstream_gene_variant ; 318.0bp to feature; MODIFIER	silent_mutation	Average:78.73; most accessible tissue: Callus, score: 85.695	N	N	N	N
vg0517961716	G -> A	LOC_Os05g30950.1	downstream_gene_variant ; 3345.0bp to feature; MODIFIER	silent_mutation	Average:78.73; most accessible tissue: Callus, score: 85.695	N	N	N	N
vg0517961716	G -> A	LOC_Os05g30950.3	downstream_gene_variant ; 3345.0bp to feature; MODIFIER	silent_mutation	Average:78.73; most accessible tissue: Callus, score: 85.695	N	N	N	N
vg0517961716	G -> A	LOC_Os05g30930-LOC_Os05g30940	intergenic_region ; MODIFIER	silent_mutation	Average:78.73; most accessible tissue: Callus, score: 85.695	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517961716	NA	7.67E-06	mr1002	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	3.66E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	2.91E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	1.53E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	7.82E-06	mr1698	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	5.65E-07	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	3.06E-08	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	1.35E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	1.53E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	1.27E-06	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	1.06E-06	mr1399_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	9.28E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	2.11E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	1.49E-06	8.29E-09	mr1544_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	5.06E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	6.69E-06	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517961716	NA	6.76E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251