\
| Variant ID: vg0517841440 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17841440 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 103. )
AAATAATCCACAGCTTCTAAGAATCTGTAGTTATAGATTCTGAAAAATGAACTAAGAAGCCAGAAGCTGGAGAAGCTGGGTTTCAGAGTTTTTCCAGATT[C/T]
TCAGAAGCTGGCTACCAAACAGCTGCTTCTCAGAATCTAAAGCTCCTCCAAACAGACCCGTAGTCCATCAATTTAAGTCTTAGTAATATGCAAATTTAGG
CCTAAATTTGCATATTACTAAGACTTAAATTGATGGACTACGGGTCTGTTTGGAGGAGCTTTAGATTCTGAGAAGCAGCTGTTTGGTAGCCAGCTTCTGA[G/A]
AATCTGGAAAAACTCTGAAACCCAGCTTCTCCAGCTTCTGGCTTCTTAGTTCATTTTTCAGAATCTATAACTACAGATTCTTAGAAGCTGTGGATTATTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.40% | 35.30% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 94.10% | 5.70% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 8.30% | 91.30% | 0.33% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.60% | 24.70% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 18.50% | 81.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 95.90% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 91.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 45.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517841440 | C -> T | LOC_Os05g30770.1 | upstream_gene_variant ; 4382.0bp to feature; MODIFIER | silent_mutation | Average:45.19; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0517841440 | C -> T | LOC_Os05g30780.1 | downstream_gene_variant ; 706.0bp to feature; MODIFIER | silent_mutation | Average:45.19; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0517841440 | C -> T | LOC_Os05g30770-LOC_Os05g30780 | intergenic_region ; MODIFIER | silent_mutation | Average:45.19; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517841440 | 5.40E-07 | NA | mr1155_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517841440 | NA | 2.03E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517841440 | NA | 1.11E-07 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517841440 | NA | 4.29E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517841440 | NA | 1.15E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517841440 | NA | 9.54E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517841440 | NA | 2.86E-07 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517841440 | NA | 2.32E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |